ID: 1116354701

View in Genome Browser
Species Human (GRCh38)
Location 14:43914021-43914043
Sequence GTGATTGTGGGACTTTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 9, 1: 67, 2: 140, 3: 170, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116354695_1116354701 26 Left 1116354695 14:43913972-43913994 CCACATGTCATGGGGAGAGAATC No data
Right 1116354701 14:43914021-43914043 GTGATTGTGGGACTTTGCACTGG 0: 9
1: 67
2: 140
3: 170
4: 293
1116354694_1116354701 30 Left 1116354694 14:43913968-43913990 CCAGCCACATGTCATGGGGAGAG No data
Right 1116354701 14:43914021-43914043 GTGATTGTGGGACTTTGCACTGG 0: 9
1: 67
2: 140
3: 170
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116354701 Original CRISPR GTGATTGTGGGACTTTGCAC TGG Intergenic
901379448 1:8863239-8863261 CTGGTTGTGGGGCTGTGCACTGG - Exonic
903125433 1:21244450-21244472 GTGGCTGTGGAACTTTCCACTGG + Intronic
903353691 1:22733416-22733438 ATCACTGTGTGACTTTGCACAGG - Intronic
906827171 1:48993792-48993814 GTGATTGTGGGACTTTGTATTGG - Intronic
906915380 1:50004144-50004166 GTGATTGTGGGACTTTTCATTGG + Intronic
907023636 1:51094224-51094246 GTGATTTTGGGACTTTGCACTGG + Intergenic
907261521 1:53221933-53221955 GTGCTTATGGGACTTTGCATTGG + Intergenic
908093021 1:60706660-60706682 GTGACTGTGGGACTTTGCGTAGG + Intergenic
908175704 1:61553140-61553162 CTGATTGTGGGACTTTGCATTGG - Intergenic
908363272 1:63390788-63390810 GTGACTATGGGACTCTGCACTGG - Intronic
908397693 1:63741200-63741222 GTGATTGTGGAACTTTGCATTGG - Intergenic
909231343 1:73094039-73094061 GTGCCTGTGGGACTTTGCATTGG - Intergenic
909320570 1:74280536-74280558 GTGATTGTCAGACTTTGCATTGG + Intronic
909582463 1:77253479-77253501 GTGATTGTGGGACTTTGCATTGG + Intergenic
909870363 1:80731143-80731165 GTGATTGTGGGACTTTGCATTGG + Intergenic
910102607 1:83594533-83594555 GTAATTGTAGGACTTTGTATTGG - Intergenic
910384226 1:86664362-86664384 GTGATTACAGGATTTTGCACTGG + Intergenic
910384429 1:86665558-86665580 GTGATTACAGGATTTTGCACTGG - Intergenic
910470524 1:87547733-87547755 GTGACTGTGGGACTTTGCATTGG - Intergenic
910643415 1:89488893-89488915 GTGATTTTGAGACCTTGCATTGG + Intergenic
910724846 1:90327805-90327827 GTGATTGTGGGACTTTGCATTGG + Intergenic
911011610 1:93287196-93287218 GTGATTCTGGGGCTTTGCATTGG + Intergenic
911012599 1:93297045-93297067 GTGATTTTGGGACTTTGCATTGG - Intergenic
911239519 1:95449682-95449704 GTGCTTGTGGGACTTTGCATTGG - Intergenic
911344100 1:96675115-96675137 GTGATTGTGGAAATTTGCAATGG - Intergenic
911666407 1:100557735-100557757 GTGAGTGTTGAACTTTGCATTGG - Intergenic
911979792 1:104552490-104552512 GAGATTGTGGCACTACGCACTGG + Intergenic
912633374 1:111268291-111268313 GTGATTGTAGGACTTTGCACTGG - Intergenic
912643822 1:111372287-111372309 GTGATTGTGGGACTTTGCACTGG + Intergenic
912871408 1:113310492-113310514 GGGATTGTGGGACTTTGTATTGG + Intergenic
912873240 1:113328851-113328873 GTAATTGTGGGAATTTGCACTGG - Intergenic
913147192 1:116003612-116003634 GTGATAATGGAACTTTGCATTGG - Intronic
914218550 1:145656356-145656378 GTGATTGTGGCACCCTGCCCAGG - Intronic
914471109 1:147979047-147979069 GTGATTGTGGCACCCTGCCCAGG - Intronic
915649922 1:157302208-157302230 GTCATGGTGGGAACTTGCACAGG + Intergenic
915752663 1:158226773-158226795 GTGATTGTGGGACTTCACATTGG + Intergenic
916224391 1:162475105-162475127 CTGATTGTGGGACTTTGCATTGG + Intergenic
916321714 1:163512228-163512250 AGTATTGTGGGACTTTGCATTGG + Intergenic
916666019 1:166968249-166968271 CTGATTCTTGGCCTTTGCACAGG + Intronic
916993290 1:170267862-170267884 GTGATTGTTGTACTTTGCATTGG - Intergenic
917376548 1:174353707-174353729 GTGACTGTGAAACTTTGCATTGG - Intronic
917397036 1:174604334-174604356 GTGATTGTGGGACTTTGCTTTGG - Intronic
917405038 1:174696666-174696688 GGGATTGTGGGACTTTGCACTGG - Intronic
917581559 1:176383732-176383754 TTGATTGTGGGTCTTTTCATAGG + Intergenic
918357893 1:183723517-183723539 GTGACTGTGGGACCTTGCATTGG + Intronic
918892706 1:190295741-190295763 GTGAGTGTGGGAATTTGCATTGG - Intronic
919047383 1:192470409-192470431 GTGATTGTGGGAATTTGCACTGG - Intergenic
919147335 1:193651923-193651945 GTAACTGTGGGACTTTGCATTGG - Intergenic
919722794 1:200857327-200857349 GTGCTTATTGGATTTTGCACTGG - Exonic
920953766 1:210598618-210598640 GTGACTGTGGGACTTGGCACTGG - Intronic
921002147 1:211055269-211055291 GTGATTGTGGGACTTTGCATTGG + Intronic
921769649 1:219021495-219021517 GTAATTTTGGGACTTTGCATTGG + Intergenic
921774668 1:219082772-219082794 GTGATTGTGGGACTTTGCATTGG - Intergenic
921929503 1:220743544-220743566 GCGATTGTGGAACTTTGCATTGG - Intergenic
922320593 1:224483016-224483038 TTGATTGTGAGATTTTGCACTGG - Intronic
922672587 1:227522350-227522372 GTGATTGTGTGACTCTACCCGGG - Intergenic
924481582 1:244439942-244439964 GTGATCATAGGACTTTGCATTGG - Intronic
924490925 1:244536550-244536572 GTGATTGTGGGACTTTCCGTCGG - Intronic
924516318 1:244768999-244769021 GTGACTGGGGGACTTTGCATTGG - Intergenic
1062761701 10:27684-27706 GGGATTGTGCGACTCTGCCCGGG + Intergenic
1063943717 10:11157145-11157167 GTGCATGGGTGACTTTGCACAGG - Intronic
1064162980 10:12961514-12961536 GTCATTGTGAGCCTTTGCAAAGG + Intronic
1064987628 10:21226663-21226685 GTGATTGTGGGATTTGGTATTGG - Intergenic
1067218668 10:44325250-44325272 GTCACTGTGGGACTTTGAGCTGG + Intergenic
1068447822 10:57146190-57146212 GTGGTTGTGGGATTCTGCATTGG + Intergenic
1068853116 10:61767602-61767624 GTGAGTGTGTGACCTTGGACAGG + Intergenic
1070464135 10:76702890-76702912 GTGATCATGGGATTTTGCATTGG + Intergenic
1070895356 10:79979515-79979537 GTGATTATGGAACTTTGCATTGG + Intronic
1071799547 10:89043337-89043359 ATGATTGTAGGACTTTGCATTGG - Intergenic
1071962550 10:90821342-90821364 GTGATTGTGGGACTTTGCATTGG + Intronic
1072492499 10:95921305-95921327 GTGATTGGGGGACTTTGCATTGG - Intronic
1072509160 10:96101001-96101023 GTGATTTTGGGAATTTGCCTTGG - Intergenic
1073112575 10:101071308-101071330 GTAATGGTGGGTCTTTGCATAGG + Intergenic
1073983171 10:109177950-109177972 GTGATAGTGGGACTTTTGTCTGG - Intergenic
1075830647 10:125408048-125408070 GTGATTGTGGTACTTTGTATTGG - Intergenic
1076376710 10:129993158-129993180 GTGATTGTGGGACTTTGAATTGG + Intergenic
1077489474 11:2853790-2853812 CTGTTTGTGTGACTTTGCATTGG + Intergenic
1077911880 11:6579607-6579629 GTGATTGTGGGACTTTGCATTGG + Intronic
1078244717 11:9563606-9563628 GCTATTGTGGGATTTTGCATTGG - Intergenic
1078528932 11:12121492-12121514 GTGATTGTGAGGCTGTGCAGAGG - Intronic
1078737654 11:14035299-14035321 GCCATTCTGGGACTTTGGACAGG + Intronic
1078992522 11:16664399-16664421 GTGATTGTGGAACTTAGCATTGG + Intronic
1079473997 11:20808785-20808807 ATGATTGTGGGACTTTGCATTGG - Intronic
1079760145 11:24319136-24319158 AGGATTGTGGGATTTTGCATTGG - Intergenic
1079937730 11:26638415-26638437 TAGATTGTGGGACATTCCACAGG + Intronic
1080096880 11:28418787-28418809 GTGAATGTGGGACTTTGCATTGG + Intergenic
1080330220 11:31128672-31128694 CTGACTGGGAGACTTTGCACAGG + Intronic
1080862342 11:36160741-36160763 GTCATTGTGTGACTTTGAGCTGG - Intronic
1080966639 11:37220555-37220577 GTGATCGTGGGACTTTGCATTGG - Intergenic
1081245654 11:40763665-40763687 GTGATTGTGGGACTTTGTATCGG + Intronic
1083528934 11:63398615-63398637 GTGATTGTGGGACTTTGCATTGG - Intronic
1084763959 11:71295389-71295411 GTGATTGTGGGACTTTGCATTGG - Intergenic
1085147200 11:74212208-74212230 GTGATTGTGTGACTTTGCATTGG + Intronic
1085686908 11:78631705-78631727 GCGAGTGTGGGAGTTTGCACTGG - Intergenic
1085980405 11:81717879-81717901 GTGATTGTGGGACTTTGCATTGG + Intergenic
1086021910 11:82240151-82240173 GTGATTGTGCGACCCTGCCCGGG - Intergenic
1086277373 11:85147014-85147036 GTGATTGTGAGACATTGCATTGG - Intronic
1086569520 11:88266039-88266061 ATGATTGTGGGACTTAGCACTGG + Intergenic
1087032135 11:93716270-93716292 GCCATTCTGGGACTTTGCATTGG - Intronic
1087080562 11:94167152-94167174 ATGAGTATGCGACTTTGCACTGG - Intronic
1087473097 11:98601635-98601657 ATGATTGTAGGATATTGCACTGG - Intergenic
1087498274 11:98917949-98917971 GTGATCATGGGAGTTTGCATTGG - Intergenic
1087790182 11:102397798-102397820 GGGATTGTGGGACTTCCCCCAGG - Exonic
1087824496 11:102749552-102749574 GTGATTGTGAGACTTTGCATTGG - Intergenic
1088181706 11:107120769-107120791 GTGATTGTGGAACTTTCCATTGG + Intergenic
1089593115 11:119557616-119557638 GAGAATGTGGGACATTTCACAGG + Intergenic
1090210490 11:124917554-124917576 GTCATTGTGGGGCTTTGCATTGG - Intergenic
1091328716 11:134713605-134713627 GTGAGTGTGGGACCCAGCACAGG + Intergenic
1091817152 12:3447120-3447142 GTGCTTTTCGGTCTTTGCACGGG - Intronic
1092497513 12:9011827-9011849 GTGATTATGGGACTTTGCAGTGG + Intergenic
1093321380 12:17719077-17719099 GTGACTGTGGAACTTTACATTGG - Intergenic
1093420134 12:18965348-18965370 GCTATTGTGAGACTTTGCATTGG - Intergenic
1093531898 12:20175240-20175262 GTGACTGTGGGAATTTGCATTGG - Intergenic
1093903446 12:24662015-24662037 GTGATTGTGCAATTTTGCATTGG - Intergenic
1093931627 12:24960341-24960363 GTGACTGTGGGACTTTGCGTTGG + Intergenic
1094757449 12:33489133-33489155 GTGATTGTGAGACTTTGCATTGG + Intergenic
1094811450 12:34142616-34142638 GTGATTGTGCGACTCTGTCCGGG + Intergenic
1095181822 12:39154793-39154815 GCAATTGTGGGACTTTGCATTGG - Intergenic
1095625002 12:44304206-44304228 GTGACTATGGGACTTTGCATTGG + Intronic
1095860142 12:46907814-46907836 GTGACTGTGGGACTTTGCATTGG + Intergenic
1096448460 12:51716654-51716676 GTGATTGTGGCATTTAGCAAAGG + Intronic
1097426139 12:59446695-59446717 GTGATTCTGGGACTTTGCATTGG - Intergenic
1098060202 12:66553762-66553784 GTGATTTTGGGACTTTGCATTGG + Intronic
1098582864 12:72121508-72121530 GTGATTGCGGTACTTTGCATTGG - Intronic
1098959031 12:76719150-76719172 GTGAGTGTGGTACTTTGCATTGG + Intergenic
1099491307 12:83292072-83292094 GTGATTGTGGGGCTTTGCATTGG + Intergenic
1099523214 12:83689435-83689457 GTGATTGTGGGACTTTGTATTGG + Intergenic
1099757784 12:86876879-86876901 GTGACTGTGGGACTTTGCATTGG - Intergenic
1101702331 12:107185935-107185957 GTGATTGTATTACTTTGCAAGGG - Intergenic
1102702673 12:114853251-114853273 TTGCTTGTGGGAATGTGCACTGG - Intergenic
1104369966 12:128215807-128215829 GTGATTATGTGACCTTGCATAGG + Intergenic
1104751738 12:131244545-131244567 GGGATGGAGGGGCTTTGCACTGG + Intergenic
1104780156 12:131414530-131414552 GGGATGGAGGGGCTTTGCACTGG - Intergenic
1106074657 13:26447918-26447940 GTGATTACGGGGCTTTGCATTGG + Intergenic
1106585895 13:31055865-31055887 GTGATTGTGTGTGTATGCACAGG - Intergenic
1106895887 13:34302093-34302115 GCAATTGTGAGACATTGCACTGG + Intergenic
1107370281 13:39737946-39737968 GTGATTGTGGGACGTAGCACTGG - Intronic
1107582144 13:41802229-41802251 TTGATTGTGGTATTTTGCATTGG + Intronic
1107808345 13:44175535-44175557 GTGATTGTGGGATTTTGCGTTGG - Intergenic
1108487921 13:50945903-50945925 CTAGTTGTGAGACTTTGCACAGG - Intronic
1108879151 13:55087617-55087639 GTTACTGTGGAACTTTGCATTGG - Intergenic
1109341916 13:61073379-61073401 CTGATTTTGGAATTTTGCACTGG - Intergenic
1109439968 13:62357382-62357404 GTGAGTGTGAGACTTTGTATTGG + Intergenic
1109554628 13:63955807-63955829 GGGAGTATGGGACTTTGCATTGG - Intergenic
1109747533 13:66646910-66646932 GTGATTGTGAGACTTTGCATTGG + Intronic
1109923729 13:69106211-69106233 GTGAGTGTGGGGCTTTGCATTGG + Intergenic
1109961759 13:69640012-69640034 ATGATTGCGGGACTTTGCGTTGG - Intergenic
1111077007 13:83249597-83249619 GTGATTGTGGAACTTTGCACTGG - Intergenic
1111335460 13:86815777-86815799 GTGATTGTGGGACCTTGCATTGG + Intergenic
1111446693 13:88355514-88355536 GTGAGTGTGGAACTTTGCACTGG + Intergenic
1111583450 13:90253730-90253752 GTGAGTGTGGCACCTTGCATTGG - Intergenic
1112037669 13:95512635-95512657 GTGACTGGGGGACATGGCACAGG - Intronic
1112657963 13:101473361-101473383 GTGATTGTGGAACTTTGGATTGG + Intronic
1112743212 13:102497809-102497831 GTGATTATGGAACTTTACATTGG + Intergenic
1112865907 13:103898257-103898279 GTGACTGTGAGACTTGGCATTGG - Intergenic
1113217497 13:108060174-108060196 GTGATTGTAGGACTTCACACTGG + Intergenic
1113704296 13:112415972-112415994 GTGAGTGTGGGACCTTGCATTGG - Intronic
1113890395 13:113732354-113732376 GTGTCTGTGGGACGTGGCACAGG + Intronic
1114820248 14:26009691-26009713 GTGACTGTGTGACTTTGCATTGG + Intergenic
1115660886 14:35493613-35493635 GTGATTGTGGGACTTTGCATTGG + Intergenic
1115930086 14:38481854-38481876 ATGATTATGGGATTTTGCATTGG + Intergenic
1116045608 14:39739711-39739733 GTGATGATGGGACTTTGCATTGG + Intergenic
1116114877 14:40635401-40635423 GTGATTGTGGGACTTCACATTGG + Intergenic
1116192480 14:41678957-41678979 GTGATTATGAGACTTTGCATTGG + Intronic
1116275722 14:42828418-42828440 GTGATTGTGGAATTTTGCACTGG - Intergenic
1116354701 14:43914021-43914043 GTGATTGTGGGACTTTGCACTGG + Intergenic
1116392727 14:44413055-44413077 GTGATTGTGAGACTTTGCATTGG + Intergenic
1116413092 14:44648992-44649014 GTGATTATGGGACTTTGCATTGG + Intergenic
1116495377 14:45553573-45553595 CAGATTCTGGGACTTTGCACTGG - Intergenic
1116546280 14:46168728-46168750 GTGAGTGTGGGCCTTTGCATTGG - Intergenic
1116583588 14:46674311-46674333 GTGATTGAAGGATTTTGCATGGG + Intergenic
1117161616 14:52995329-52995351 GTGACTATGGGACTTTGCATTGG - Intergenic
1117208571 14:53470811-53470833 GTGATTGTGGGACTTTGCATTGG - Intergenic
1117504545 14:56389097-56389119 GCGATTGTGGGACTTTGCATTGG - Intergenic
1117607104 14:57440947-57440969 GTGATTGTGGGGCTTTTCAGGGG - Intergenic
1117843142 14:59881496-59881518 GTGATTGTGGAACTTTGCATTGG - Intergenic
1117870658 14:60197464-60197486 GTGACTGTGGGATTTTGCATTGG + Intergenic
1118034281 14:61849611-61849633 GTGATTGTGGGACTTTGCATTGG - Intergenic
1118084539 14:62399476-62399498 GTGATTATGAGACTTTGCACTGG - Intergenic
1118431283 14:65720937-65720959 GTGATTGTGGGACTTTGCACTGG - Intronic
1118543430 14:66857871-66857893 GTGATTGTGAGACGTAGCATTGG + Intronic
1119083867 14:71722055-71722077 GAGGGTGTGGGACTTTGCATTGG - Intronic
1119091459 14:71785367-71785389 GTGTTCTTGGGACTTTGGACTGG + Intergenic
1120107857 14:80516732-80516754 GTGATTGTGGAACTTTGCATGGG - Intronic
1120426068 14:84350304-84350326 GTGATTGTAGGACTTTGCATTGG + Intergenic
1120439762 14:84521177-84521199 GGGACTGTGGGACTTTGCATTGG - Intergenic
1122193033 14:100062791-100062813 GTGACTGTGTGACTTTACATGGG + Intronic
1125897586 15:43315548-43315570 GAGATTGTGTGACTTCGCTCAGG + Intergenic
1126015570 15:44347425-44347447 GTAATTGTGAGACTTTGCACTGG + Intronic
1126053457 15:44708022-44708044 GTGATTTTCAGACTTTGCATTGG - Intronic
1126285905 15:47010012-47010034 GTGATTGTAGAATTTTGCATTGG - Intergenic
1126440430 15:48682877-48682899 GTGCTTGTGGAATTTTGCATTGG + Intergenic
1126486646 15:49188418-49188440 GTGATTATGGGGCTTTGCTTTGG - Intronic
1126489144 15:49216796-49216818 GTGAGTGTGGGTCTTTGCACTGG - Intronic
1126572284 15:50164891-50164913 GTGATTGTAGGACTTTGCATTGG - Intronic
1126660828 15:51031458-51031480 GTGATTGTGGGACTTTGCATTGG - Intergenic
1127132528 15:55882376-55882398 GTGACAGTGGGACTTTGCATTGG + Intronic
1127140271 15:55969141-55969163 GTGATTGTGGGACTTTGCATTGG + Intronic
1127170780 15:56299239-56299261 GTGGTTGTAGAACTTTGCATTGG + Intronic
1129133317 15:73520667-73520689 GTGGTTGTTGTACTTTGCAGTGG + Intronic
1131323628 15:91421550-91421572 GTGATTGTGAAACTTTGCATTGG - Intergenic
1131529670 15:93180627-93180649 GTCATTCTGGGACTCAGCACAGG - Intergenic
1131944801 15:97608409-97608431 GTGATTGTGGGACTTTGCATTGG + Intergenic
1133834302 16:9352316-9352338 GTGATTGTGGGGCTGTGCATTGG - Intergenic
1135375577 16:21944130-21944152 GTGATGGTGAGACCTTGCCCAGG - Intergenic
1138803550 16:60064582-60064604 ATAATTGTGGGTCTTTGCAGTGG + Intergenic
1139005039 16:62559475-62559497 GTGACTGTGGGACTTTGCCAGGG - Intergenic
1139018664 16:62721325-62721347 GTGTGTGTGTGACTTTGCACTGG - Intergenic
1140567066 16:76055946-76055968 GTGATCATGGGACTTTGTATTGG - Intergenic
1143413586 17:6728441-6728463 GTGATTGTGGGACTTTGCATCGG + Intergenic
1147439672 17:40440334-40440356 GTGAGTGTGGGAATCTGCAAAGG - Intergenic
1147530041 17:41267359-41267381 GGGATTGAGGGACTATGCAATGG + Intergenic
1149249344 17:54750021-54750043 GTGATTGTGGGACTTTGCATTGG - Intergenic
1149731075 17:58946699-58946721 GTAATTTTGGTACTTTGCAAGGG - Intronic
1150550246 17:66203462-66203484 CTGTTTGTTGGACTTTGCATTGG + Intergenic
1150870898 17:68910333-68910355 GTCATTGTGGGACTTTGCATTGG + Intronic
1151076293 17:71276966-71276988 GGGATTGTGTGATATTGCACTGG - Intergenic
1152166843 17:78714497-78714519 GTGTTTGTGGTACTCAGCACAGG + Intronic
1152954608 18:28014-28036 GGGATTGTGCGACTCTGCCCGGG + Intergenic
1153088512 18:1317662-1317684 GTGATCATGGGACTTAGCATTGG + Intergenic
1153183420 18:2460722-2460744 GTGATTGTGAGACTTTGCATTGG - Intergenic
1155443294 18:25884428-25884450 GTGATTGTGGGTCTTTGGATTGG + Intergenic
1155792758 18:29995483-29995505 GTGACTGTGGGACTTTGCATTGG + Intergenic
1156055488 18:32998179-32998201 GTGATTGTGGGACTTTGCGTTGG + Intronic
1156679842 18:39575120-39575142 CTGATTGTGGGGCCTTGCAGTGG + Intergenic
1156694680 18:39752931-39752953 CTGATTGTGCGACCTTGCCCGGG + Intergenic
1156877558 18:42033589-42033611 GTGAAAGTTGGACTTTTCACAGG - Intronic
1157879198 18:51304125-51304147 GTGATTGTGGGACTTTGCACTGG + Intergenic
1157936865 18:51883247-51883269 GTGATTGTGAGACTTTGCATTGG + Intergenic
1159285041 18:66337542-66337564 GTGACTGTGGGACTTTGCATTGG - Intergenic
1159478884 18:68960801-68960823 GTGATTGTGAGCCATTGCATTGG - Intronic
1159490657 18:69129505-69129527 GTGATTATGGGACTTTGGATTGG - Intergenic
1159647961 18:70942482-70942504 GTGATTGTGGGACTTTGCATTGG + Intergenic
1159775442 18:72598844-72598866 GCAATTTTGGGACTTTGCACTGG - Intronic
1159802679 18:72920383-72920405 GTCATTATGGGACTTTGCATTGG - Intergenic
1160147106 18:76374623-76374645 GTGATTCTGTGATTTTGCAGTGG - Intronic
1162387977 19:10371828-10371850 CTTATTGAGGGACTTTGCAATGG + Intronic
1162596031 19:11629999-11630021 GTGATTGTGGCACTTTGCATTGG + Intergenic
1163981789 19:20907572-20907594 GTGATTGGGTGACATTGAACAGG - Intergenic
1165399531 19:35589114-35589136 GTGTTTGTGGGACAATGCTCTGG + Intergenic
1165645269 19:37430897-37430919 GTGATTGCAGGACTTTTCATTGG + Intronic
1166354349 19:42218065-42218087 GTGATTGTGTTACTTTGCCACGG - Intronic
1166588040 19:43968817-43968839 GTGATTGTGCGACCCTGCGCAGG + Intronic
1167218885 19:48184290-48184312 GTGCCTCTGGGCCTTTGCACTGG - Intronic
1167515520 19:49921245-49921267 CTGGTTGTGGGACTTTACGCAGG - Intronic
1168448962 19:56448190-56448212 GTGATGGTGGGACTCTGCATTGG + Intronic
925484836 2:4316514-4316536 GTAATTGTGGGGCTTTGCACTGG - Intergenic
925491269 2:4395876-4395898 GTAAATGTGGAACTTTGCATTGG - Intergenic
925699058 2:6614358-6614380 GTGAGTGTGGGACTTTGCATTGG - Intergenic
926473642 2:13293811-13293833 GTGATTGTGAGGCGTTGCATTGG - Intergenic
926516251 2:13850657-13850679 GTAATTGTGGGACTTTGCATTGG + Intergenic
926518751 2:13883424-13883446 GTGATTGCGGGTCTTTGCATTGG + Intergenic
928483957 2:31711004-31711026 GTGATTGTGGGACTTTGCATTGG + Intergenic
928750135 2:34460729-34460751 GTGATTGTGGAATTTTGCGTTGG - Intergenic
928767857 2:34670015-34670037 GTGACTCTGGGACTTTGCAAGGG + Intergenic
928846261 2:35676843-35676865 GGGAATATGGGACTTTGCATTGG - Intergenic
929183702 2:39070757-39070779 GTGATGCTGGGGCTTTGAACTGG - Intronic
929281836 2:40088191-40088213 GTGACTGTGGGACTTTGCGTTGG - Intergenic
929529355 2:42737419-42737441 GTGATTGTGAAACTTTGCATTGG - Intronic
930041636 2:47129573-47129595 GTGACGGGGGGACTTTGCACGGG - Intronic
930230817 2:48842029-48842051 GTGATTGTGAGACTTTGCATTGG - Intergenic
930288942 2:49468757-49468779 GTGATTGTGGGACTTTGCATTGG - Intergenic
930895545 2:56441400-56441422 GTGATTGTGGGACTTTGTTTTGG - Intergenic
930971401 2:57398787-57398809 GTGATTGTGGGACTTTGCATTGG - Intergenic
930981270 2:57528767-57528789 GTGATTGTGGGACTTTTCATTGG - Intergenic
931012286 2:57930354-57930376 GTGATTGTGGAATTTTGCATTGG - Intronic
931407011 2:61988933-61988955 GCAATTGTGGGACTTTACATTGG - Intronic
932889380 2:75579015-75579037 GTGATTGTGGGACTTTGCATTGG + Intergenic
933086613 2:78061255-78061277 GTGAGTGTGGAACTTTGCATTGG + Intergenic
934928863 2:98404057-98404079 GTGATTGTGGGACTTTGCATTGG + Intergenic
935018944 2:99212120-99212142 GTGATCATGGGATTCTGCACTGG - Intronic
935478620 2:103557341-103557363 GTGATAATGGGACTTTGCATTGG - Intergenic
935764848 2:106356401-106356423 GTGATTGCTGAACTTTGAACTGG + Intergenic
935812823 2:106816923-106816945 GTGACTGGGAGACTTTGCAATGG + Intronic
935989256 2:108704795-108704817 GTGATTGTGAGACTTTGCCTTGG + Intergenic
936511402 2:113150394-113150416 GTGATTGCCGGACTTTGTATTGG - Intergenic
938587637 2:132707219-132707241 GTGACTGTGGGACTCTTCACTGG + Intronic
939144424 2:138395715-138395737 GTGACTGTGGGACTTTTCCTTGG + Intergenic
939913016 2:148006186-148006208 GTAAGTATGGGACTTTGCGCTGG + Intronic
940402667 2:153265463-153265485 GTGGTTGTGGAACTTTGCATTGG - Intergenic
940559958 2:155282262-155282284 GTGATTATGGGACTTTGCATTGG - Intergenic
941138576 2:161747350-161747372 GTGATTGTGGGACTTTGCATTGG - Intronic
941528349 2:166633013-166633035 GCAATTCTGGGACTTTGCATTGG - Intergenic
941746093 2:169088280-169088302 GTGATTGTGGGACTTTGCATTGG - Intronic
941851924 2:170191620-170191642 GTGATTGGGGAACTTTGCATTGG - Intronic
943067736 2:183106241-183106263 ATGACTGTGGAACTTTGCATTGG - Intergenic
943099655 2:183472211-183472233 GTGACTATGGGCCTTTGCATTGG - Intergenic
943302616 2:186223012-186223034 GTGATTGTGAGACTTTGCATTGG + Intergenic
943844983 2:192634482-192634504 GTGATTCTGGGACTTTGCACTGG + Intergenic
944005277 2:194897085-194897107 ACTATTGTGGGACTTTGCTCTGG - Intergenic
944006587 2:194915992-194916014 GTGTTTGTGGGAGTTTACACTGG - Intergenic
944616547 2:201465897-201465919 GTGATTGTGGGACTTTGCACTGG - Intronic
945334325 2:208573503-208573525 GTGATTGTGGGACTTGGTGTTGG + Intronic
945803847 2:214465919-214465941 GCGATTGTGCAACTTTGCATTGG - Intronic
948475615 2:238217104-238217126 GTGATTGTGGGACTTTGCACTGG - Intergenic
948774556 2:240277093-240277115 GTGACTGTGGGACTTTGCATTGG + Intergenic
948802727 2:240440164-240440186 GTGTGTGTGGGCCTTTGCAGAGG - Intronic
1168748204 20:263182-263204 GTGATTGTGGGATTTCACATTGG + Intergenic
1168900045 20:1355529-1355551 GTGATTGTGGGACACTGCAATGG - Intronic
1170864220 20:20138496-20138518 GTGACTGTGGGACTTTGCAATGG - Intronic
1171461838 20:25302441-25302463 GTGTATGTGGGACTCTGGACTGG - Intronic
1171774681 20:29354594-29354616 GTGATTGTGCGACTCTGCCCGGG + Intergenic
1171816687 20:29792210-29792232 GTGATTGTTCGACTCTGCCCGGG + Intergenic
1171942788 20:31347945-31347967 GTGATTGTGGGACTTTGCATTGG + Intergenic
1173709695 20:45143774-45143796 GTGCTTGTGGGACTCTGCATTGG - Intergenic
1174607137 20:51768783-51768805 GTGAATGTGGGATTTTGCGGGGG - Intergenic
1174690933 20:52503825-52503847 GTGACTGTGGGACTTTGCATTGG + Intergenic
1174938417 20:54897709-54897731 GTGATTGTGAAACTTAGCATTGG + Intergenic
1176940059 21:14912625-14912647 TTGATTGTGGGACTTTGCACTGG - Intergenic
1177105069 21:16945499-16945521 GAGACCGTGGGACTTTGCATTGG + Intergenic
1177137212 21:17318261-17318283 GGGATTATGTGACTTTGCATTGG + Intergenic
1177222328 21:18210279-18210301 GTGATTGTGGGACATTGCACTGG - Intronic
1177539736 21:22477121-22477143 GTAATTGTAGGACTTGGCATTGG + Intergenic
1177760655 21:25399358-25399380 GTGACTGTGGAACTTTGCATTGG + Intergenic
1178430510 21:32514740-32514762 GTTTCTGTGGGACTTGGCACTGG + Intronic
1180320160 22:11312818-11312840 GTGATTGTTCGACTCTGCCCAGG + Intergenic
1182757502 22:32691600-32691622 GGGATTGGGAGACTTTGCAGGGG + Intronic
1182784348 22:32894313-32894335 CTGATTCTGTGACTTTGCACAGG + Intronic
1184586785 22:45453364-45453386 CTGACTGGGTGACTTTGCACAGG - Intergenic
950640593 3:14345890-14345912 CTGCTTGAGGGACTTTGCAAGGG - Intergenic
950801195 3:15552962-15552984 GTAACTGTGGGACTTTGCATTGG - Intergenic
951129823 3:19029384-19029406 GTGATTGTGGGATGTTTCATTGG + Intergenic
951379644 3:21968116-21968138 GGGATTGTGGGACTTCACATTGG + Intronic
951398614 3:22202761-22202783 TTGAATGTGGGACTTTGCATGGG + Intronic
951437094 3:22677176-22677198 GTGATTGTGGGACTTTGCATGGG - Intergenic
951578465 3:24137578-24137600 CTGGCTTTGGGACTTTGCACTGG - Intronic
952688485 3:36176233-36176255 GTGATTGTGGGACTCTGCACTGG - Intergenic
952812010 3:37412322-37412344 GTGATTGTGGGACTTTGCATTGG - Intronic
953363612 3:42322834-42322856 GTGATTGTGGGACTTGCCTGAGG - Intergenic
954491476 3:50910697-50910719 GTGACTGTGGGGCTTTGCATTGG - Intronic
956013024 3:64851756-64851778 GTGAATGTGGGACTTTTTACTGG + Intergenic
956865032 3:73361221-73361243 GAGGTTGTGTGCCTTTGCACAGG - Intergenic
957018975 3:75102102-75102124 GTGATTGTGGCACTTTGCATTGG - Intergenic
957299227 3:78369420-78369442 GTGACTGAGGCACTTTTCACAGG + Intergenic
957369387 3:79272623-79272645 GTTATTGTGGAACTTTGCATTGG + Intronic
957485590 3:80858425-80858447 GTGATTGAGGGACTTAGCATTGG + Intergenic
957538097 3:81532008-81532030 GTGACTGTGGGACTTTGCATTGG - Intronic
957977088 3:87460590-87460612 GTAATTGTAGGACTTTGAATTGG + Intergenic
958147006 3:89639289-89639311 GTGACTGTGGGACTTTGCACTGG + Intergenic
958670521 3:97197964-97197986 GTGATTGTAGGACTTTGCAGTGG - Intronic
958760056 3:98296235-98296257 CTGATTGTGGGACTTTTCATTGG + Intergenic
958765986 3:98368323-98368345 GTGATTGTGGAACTTTGCACTGG - Intergenic
958777149 3:98499476-98499498 GTGATTGTGGGACTGTGGACAGG + Intronic
958837484 3:99162804-99162826 GTGATTGTGAGACTTCCCATTGG + Intergenic
958839404 3:99185938-99185960 GTGATTGTGGAACTTTGTATTGG + Intergenic
959048699 3:101503353-101503375 GTAATTGTTGGACATTGCATAGG - Intronic
959126058 3:102291313-102291335 GTGATTGTGGGACTTTGCATTGG - Intronic
959284964 3:104397195-104397217 GTGACTGTGGAATTTTGCATTGG + Intergenic
959448399 3:106468052-106468074 GTGACTGTGGGACATTGCATTGG - Intergenic
959716770 3:109442454-109442476 GCAATTGTGGGACTTTGCATTGG + Intergenic
959806709 3:110562843-110562865 GTGATTGTGGGACTTTGCTTTGG - Intergenic
959913840 3:111794285-111794307 GTGACTGCGGGACTTTGCATTGG - Intronic
960095541 3:113686280-113686302 GTGATTGTGCAACTTTGCATTGG - Intronic
960153636 3:114275771-114275793 GAGATTGTGAGACTTTGCATTGG - Intergenic
960298187 3:115968987-115969009 GTGATTGTAGGTCTTTGCATTGG - Intronic
960404030 3:117238074-117238096 GTGATTGTGGGACTTTGCATTGG + Intergenic
960471946 3:118076363-118076385 GTGATTATGGGACTTTGTATTGG - Intergenic
960862914 3:122169488-122169510 GCAATTATGGGACTTTGCATTGG - Intergenic
961610297 3:128132094-128132116 GAGATTATGGGACTTTGTACTGG + Intronic
962038898 3:131683947-131683969 GTGATTATGGGACCTTGCACTGG - Intronic
962078828 3:132115182-132115204 GTATTTGTGAGACTTTGCATTGG - Intronic
962367714 3:134796923-134796945 GTGTTTGGGGGAGTTTCCACTGG - Intronic
962638916 3:137362297-137362319 GTAATTGTGGGACTTTGCATTGG - Intergenic
962723372 3:138197111-138197133 GTGATTGTGGGTCTGGACACAGG + Intronic
962870965 3:139492477-139492499 GTAATTGTGAAACTTTGCATTGG - Intergenic
962997977 3:140650732-140650754 GTGATTGTGGGATTTTGCATTGG + Intergenic
963020593 3:140869448-140869470 GTGATTGTGAGACTTTGCATTGG - Intergenic
963154024 3:142077055-142077077 GTGACTGTGGGACTCTGTATTGG + Intronic
963346481 3:144100986-144101008 GAGATTATGGGACTTTGGATAGG - Intergenic
963430574 3:145196977-145196999 GTGATTGTGGGACCTTGCACCGG + Intergenic
963443616 3:145373916-145373938 GTGATTGTGGAACTTTGTATTGG + Intergenic
963528850 3:146447973-146447995 GTGATTGTGGGACTTTGCATTGG - Intronic
963572028 3:147009365-147009387 GTAATTGTGGGACATTGCATTGG - Intergenic
963701283 3:148629998-148630020 GTGATTATGGGACTTTGCAATGG + Intergenic
964151562 3:153531765-153531787 GTGTTTGTGGGACCTTGTATTGG + Intergenic
964253589 3:154749458-154749480 ATGATTATGGGACTTTGCATTGG + Intergenic
964583007 3:158260854-158260876 GTGATTGTGGGACTTTATGTTGG - Intronic
964686665 3:159403499-159403521 GTGATTGAGGGACTTCGCATTGG + Intronic
965020203 3:163218839-163218861 GTTATTGTGGAACTTTGCATAGG - Intergenic
965156012 3:165056617-165056639 GTGATTGTGGTCTTTTGCATTGG + Intronic
965317239 3:167208017-167208039 GTGATTGTGATACTTAGCATTGG + Intergenic
965535359 3:169818157-169818179 GTGACTGTGGGGCTTTGGAATGG - Intergenic
965547975 3:169934626-169934648 GTAATTGTGGGACTCTGCATTGG + Intronic
965844396 3:172945592-172945614 GTAATTGTGGGACTTTGTATTGG + Intronic
965867134 3:173217589-173217611 GTGATTGTGGAACTTCACATTGG - Intergenic
966454106 3:180095047-180095069 GTGATTGTGGGATTTTGCATTGG - Intergenic
966771993 3:183512210-183512232 GTGATCGTGGTATTTTGCACTGG - Intronic
967636511 3:191808166-191808188 GTAATTGTGGAACTTTGCACTGG + Intergenic
967697060 3:192544165-192544187 GTGATTGTGGGACTTTGCATTGG - Intronic
968005119 3:195237350-195237372 GCAGTTGTGGGACTTTGCATTGG - Intronic
968359115 3:198134124-198134146 GTGATTGTGCGACTCTGCCCGGG - Intergenic
970098077 4:12487437-12487459 GTGATTGTGAGACTTTGCATTGG - Intergenic
970892737 4:21066597-21066619 GTGATTGTGAGACTTAGCATTGG + Intronic
972186987 4:36541548-36541570 CCTATTGTGGGACTTTGCCCTGG - Intergenic
972579055 4:40379181-40379203 GTGATTATGGGATGTTGCATTGG + Intergenic
973060526 4:45718582-45718604 GTGATTGTGGAACGTTGCATTGG + Intergenic
973073926 4:45899563-45899585 ATGACTGTGGGACTTTGCACTGG + Intergenic
973214509 4:47654519-47654541 GTGATTGTGGGACTTTGCATTGG + Intronic
973287944 4:48440416-48440438 GTGACTGTGGGACTTTGCTTTGG - Intergenic
973348444 4:49082270-49082292 GTGATTGTGGGACTTTGCATTGG + Intergenic
973861966 4:55074564-55074586 GAGATTCTGGTGCTTTGCACGGG - Intergenic
973919937 4:55674314-55674336 GTGATTGTGGGACTTTTCATTGG - Intergenic
974285754 4:59864999-59865021 ATGATTCTGGGATTTTGCATTGG - Intergenic
974530923 4:63107178-63107200 ATGAGTTTGGGACTTTACACTGG + Intergenic
974559162 4:63494893-63494915 GTAATGGTGGGATTTTGCATTGG + Intergenic
974771695 4:66423140-66423162 ATGATTGTGCGTCTTTGCATTGG + Intergenic
975295140 4:72726135-72726157 GTGATTGTGGGACTTTGTGTTGG + Intergenic
975463569 4:74683572-74683594 GTGATATTGGGACTTTGCATTGG - Intergenic
975909479 4:79250070-79250092 GTGATTGTGTGACCCCGCACAGG + Intronic
976721952 4:88177781-88177803 GCGATTATGGGACTTCGCATTGG + Intronic
976762886 4:88569255-88569277 GGGATTGTGGGACTTTCCATTGG - Intronic
976912397 4:90323540-90323562 GTGATTGTGAGGCTTTGCATTGG - Intronic
977074329 4:92433538-92433560 ATGATTGTGGGACTTGGCATTGG - Intronic
977167003 4:93711686-93711708 CTGATTGTGGGACTTTGCACTGG - Intronic
977307334 4:95341865-95341887 GTGATTGTGCGACTTTGCATTGG + Intronic
978258182 4:106718167-106718189 GTGATTGTGAGACTTCGCATTGG + Intergenic
978654253 4:111048223-111048245 GTGATTGTGGGACTTTGTGCTGG + Intergenic
979111272 4:116761164-116761186 GTGATTGTGGGACTTTGCATTGG + Intergenic
979565188 4:122146450-122146472 GTGATTGTGGGACTTCACTTTGG - Intergenic
979945726 4:126829547-126829569 GTGATTGCGGGACTTTGCATTGG + Intergenic
980622097 4:135320783-135320805 GTGATTACGGGACCTTGCATTGG - Intergenic
980646582 4:135651343-135651365 GTGATTGTGGGACTTTGCATTGG + Intergenic
981286402 4:143024195-143024217 GTGATTGTGGGACTTTGCATTGG + Intergenic
982339724 4:154284601-154284623 GTGATTGTGGGACTCTGCATTGG + Intronic
982622663 4:157727076-157727098 GTGATTGTGGAACTTCACATTGG + Intergenic
982932571 4:161428087-161428109 GTGGTTTTAGGACTTTGCAATGG + Intronic
983050217 4:163037822-163037844 GTAATTGTGGGACTCTGCATTGG + Intergenic
983417628 4:167479381-167479403 GTGACTGTGGGACTCTGCACTGG + Intergenic
983755379 4:171328662-171328684 GTGAGTGTGGGACTTCGCATTGG + Intergenic
983774977 4:171595159-171595181 GTGATTGTGCTACTCTGCCCTGG - Intergenic
983926867 4:173412133-173412155 GTGGTTTTGGGACTTGGGACTGG - Intergenic
986085201 5:4437933-4437955 GTGATTGTGGGGATTTGCATTGG - Intergenic
986422381 5:7598173-7598195 GTGACTGTAGGACTCAGCACAGG - Intronic
986885336 5:12226740-12226762 GTGATTGTGAGACTTTGCATTGG - Intergenic
987338098 5:16914866-16914888 CTGGCTGTGGGACTTTGCAAGGG + Intronic
987564182 5:19563930-19563952 ATGATTATGAGACTTTGCATTGG + Intronic
987645778 5:20671256-20671278 GTGACTGTGGGACTCTGTATTGG + Intergenic
987759394 5:22140785-22140807 ATGATGGTGTGAGTTTGCACAGG - Intronic
987903780 5:24050040-24050062 GTGATTGTGGGTCTTCACATTGG + Intronic
988064580 5:26218361-26218383 GTGATGATAGGACTTTGCATTGG + Intergenic
988117717 5:26919274-26919296 GTGATTGTGAAACTTTGCATTGG + Intronic
988384076 5:30539167-30539189 GTGATTGCAGGACTTTGCACTGG + Intergenic
988608643 5:32704147-32704169 ATGACTGTGGGACTTTGCACTGG - Intronic
989276863 5:39599252-39599274 GTGATTGTGCTACCTTGCCCAGG - Intergenic
990899846 5:60738581-60738603 GCGATTGTGAAACTTTGCATTGG + Intergenic
991209248 5:64085200-64085222 GTGACTGTGGGACTCTACATTGG - Intergenic
991395409 5:66199268-66199290 GCAATTGTGGGACTTTGCATTGG - Intergenic
991894116 5:71374215-71374237 ATGATGGTGTGAGTTTGCACAGG - Intergenic
992531912 5:77660104-77660126 GTGATTGTGGGCCTGTGCATTGG - Intergenic
992657113 5:78921921-78921943 GCGATTGTGGGACTGTGCACTGG + Intronic
992934419 5:81687203-81687225 GTGACTGTGGGACTTCGCATTGG + Intronic
993060169 5:83029498-83029520 GTGATTGTGGGACTTAGCATTGG + Intergenic
993138254 5:83997840-83997862 GTGATTGTGGGACTGTGCATTGG + Intronic
993256986 5:85604483-85604505 GTGACGGTGGGACTTTTCATTGG + Intergenic
993269102 5:85770442-85770464 GAGAATCTGGGACTTTGCATTGG - Intergenic
993932314 5:93954945-93954967 GTGACTGTGGGACTCTGCATTGG - Intronic
994533645 5:100999679-100999701 GTGAGTGTGGGTCTTTGCACTGG + Intergenic
995492265 5:112705886-112705908 GTGATTGTGGGACAGTGGGCAGG - Intergenic
996463456 5:123772909-123772931 GTGAGTATGGAACTTTGCATTGG - Intergenic
996653714 5:125913980-125914002 GTGATTGTGGGACTTTGCATTGG - Intergenic
996944910 5:129055420-129055442 GTGATTGTGAGACTTTGCATTGG + Intergenic
997104508 5:131003936-131003958 GTGATTGTGCGACTTTGCATTGG + Intergenic
997569140 5:134912478-134912500 GTGATTTGGGGACTTTACTCTGG + Intronic
998913366 5:146986230-146986252 GTGTGTGTGAGACTTTGCATTGG + Intronic
999550404 5:152680265-152680287 CTGATAGTGGGACTTTGAAAGGG - Intergenic
999559449 5:152785129-152785151 CTGACTGTGGGACTTTGCATTGG + Intergenic
999654291 5:153797349-153797371 GTGGCTTTGGGACTTTGGACAGG - Intronic
1000433412 5:161179322-161179344 GTGATGGTGGGACTTTGCATTGG + Intergenic
1000539412 5:162521183-162521205 GTGATTGTGGCACTTTGCATTGG - Intergenic
1002009884 5:176270681-176270703 GTGATTGTGAGACTTTGCATTGG + Intronic
1002216844 5:177641627-177641649 GTGATTGTGAGACTTTGCATCGG - Intergenic
1002911362 6:1493529-1493551 TTGATTGAGGGACTTTACATGGG - Intergenic
1006554374 6:34852953-34852975 GTAATTATGGGACTTTGCATTGG - Intronic
1007001765 6:38320066-38320088 GCGATTGTGGGGCTTTGCATTGG - Intronic
1007021744 6:38528129-38528151 GTGACTGTGGGACTTTGCATTGG + Intronic
1007190460 6:40012139-40012161 AGGACTGTGGGACTTTGCATTGG - Intergenic
1008101146 6:47392483-47392505 GTGACTGTGGGACTTTGCATTGG - Intergenic
1008192268 6:48474850-48474872 GTAACTGTGGGACTTTACACTGG + Intergenic
1008238793 6:49083704-49083726 GTGATGGTGGGACTTTGCATTGG + Intergenic
1008731894 6:54492435-54492457 GCAACTGTGGGACTTTGCATTGG - Intergenic
1008881786 6:56387631-56387653 GAGTGTGTGGGACTTTGCACTGG + Intronic
1009039462 6:58159090-58159112 GTGATTATGGGATTCTGCATTGG - Intergenic
1009215354 6:60913930-60913952 GTGATTATGGGATTCTGCATTGG - Intergenic
1009744738 6:67798310-67798332 GTGGTTGTGGGATTTTGCGTTGG + Intergenic
1009847455 6:69151388-69151410 GTGATTGTGGGACTTTGCAATGG - Intronic
1010062271 6:71636466-71636488 GTGATTGTGGGACTTTGCATTGG - Intergenic
1010557814 6:77306514-77306536 GGAATTGTGGGACTTTGCATTGG - Intergenic
1011018858 6:82788618-82788640 GAGCTTGTCGGAATTTGCACTGG + Intergenic
1011343138 6:86339826-86339848 GTGATTGTGAGACTTCACATTGG + Intergenic
1011359813 6:86511359-86511381 GTAATTGTGGGACTTTGCATTGG - Intergenic
1012047725 6:94300415-94300437 GTTATTGTGGGATTTTGCATTGG + Intergenic
1012059768 6:94463408-94463430 GTGATTGTGGGACTTTGCTTTGG - Intergenic
1012142561 6:95642422-95642444 GTGATTATGAGACTCTGCTCAGG + Intergenic
1012190673 6:96276392-96276414 GTGATTGTGAGACTTTGCATTGG + Intergenic
1012397759 6:98819467-98819489 GTCATTTGGGGACTTAGCACTGG - Intergenic
1012824237 6:104126809-104126831 GTGATTGTGGAATCTTGCATTGG - Intergenic
1012892006 6:104907589-104907611 GTGATTGTGGGATTTTGTATTGG + Intergenic
1013908452 6:115245948-115245970 GCGATTGTGGGACTTTGCATGGG + Intergenic
1014378654 6:120711168-120711190 CTGATTGTGGGACTTTGGAGTGG + Intergenic
1014430537 6:121365391-121365413 GCAATTGTGGGTCTCTGCACTGG + Intergenic
1014794607 6:125710336-125710358 GGAATTGTGGGACTTTTCATTGG + Intergenic
1015392789 6:132701860-132701882 GTGATTGTGGGACTTTACATTGG + Intronic
1015578933 6:134702458-134702480 GTGACTGTGGGACTTTGCCTTGG - Intergenic
1016054842 6:139567508-139567530 GTGATTGTGGGACTTTGCGTTGG - Intergenic
1016194521 6:141317564-141317586 GTGATTGTGTGACTTTGCATTGG + Intergenic
1016229685 6:141788291-141788313 GTAATTGTGGGACTTTGCACTGG + Intergenic
1017650390 6:156576181-156576203 GTGAGTGTGGGACTTCACATCGG + Intergenic
1019844636 7:3485421-3485443 GTGAGTGTGGGACTTGGCATTGG - Intronic
1020485505 7:8715218-8715240 GTGATTGTGGAACTTTGCATTGG - Intronic
1020574934 7:9913985-9914007 GTGATTGTGGGACTTTGCATTGG - Intergenic
1020577089 7:9947122-9947144 GTGAGTGTGAAACTTTGCATTGG + Intergenic
1021214739 7:17901597-17901619 GTGATTATGGGACTTTGCATTGG - Intronic
1021922979 7:25505725-25505747 ATGACTGTAGGACTTTGCATTGG + Intergenic
1023208996 7:37782771-37782793 GTAATTGTGGGGCTTTGCATTGG - Intronic
1023716137 7:43046315-43046337 GTGATTGTGGGACTTTGCTTTGG + Intergenic
1024343107 7:48286957-48286979 GTCATTGTGGCACCTAGCACAGG - Intronic
1024483131 7:49885917-49885939 GTGATTCTGGGGCTGTGCAGAGG + Intronic
1025061537 7:55812860-55812882 GTGATTGTGGGACTTTGCATTGG + Intronic
1025862066 7:65339478-65339500 GGGATTGTTGAACTTTGCATTGG - Intergenic
1027405518 7:77855770-77855792 GTGATTATGAGACTTTGCATTGG - Intronic
1027523956 7:79244463-79244485 GTGATTGTGGGACTTTGCATTGG + Intronic
1027604765 7:80287316-80287338 GTGATTGTAGGACTTTGCATTGG + Intergenic
1027826102 7:83118556-83118578 GTGATTGTAGGACCCTGCATTGG + Intronic
1027921287 7:84399137-84399159 GTGAGTGTGGGATTATGCATTGG + Intronic
1028033637 7:85950566-85950588 GCAAATCTGGGACTTTGCACTGG - Intergenic
1028207661 7:88034807-88034829 GCAATTGTGGGACTTTGCGTTGG - Intronic
1028266699 7:88734293-88734315 GTGATTATGGGACTTTGTCTTGG - Intergenic
1028353519 7:89879003-89879025 GTGATTATGGGACTTTTAATTGG - Intergenic
1028929663 7:96398402-96398424 GTGATTGTGGGACTTTGCATTGG - Intergenic
1028972469 7:96874804-96874826 GTGATTGTGGGACTTTGCATTGG + Intergenic
1030391398 7:108932197-108932219 GTGATTGTGAGACTTTGCATTGG - Intergenic
1030662622 7:112238259-112238281 GTAATTGTGGGGCATTGCATTGG + Intronic
1030665500 7:112273344-112273366 GTGATTGTGCGACTTTGCATTGG - Intronic
1030990227 7:116290861-116290883 GTGACTGTGGAATTTTGCATTGG + Intronic
1031051404 7:116949776-116949798 GTGATTGTGTGCCATTCCACTGG + Intergenic
1031306149 7:120130332-120130354 GTAATTTTGGGACTTTGCATTGG + Intergenic
1031388389 7:121181790-121181812 GTGGTTGAGTGACTTTCCACAGG + Intronic
1031412598 7:121457428-121457450 GTGACTGTGGGACTTTGCGTTGG - Intergenic
1031546389 7:123054997-123055019 GTGATTGTGGGACTTCTCATTGG - Intergenic
1031565839 7:123296185-123296207 GTGATGATGGGACTTTGCATTGG + Intergenic
1031657737 7:124379464-124379486 GTGATCATGGGACCTTGCATTGG + Intergenic
1031753666 7:125611471-125611493 GTGATTATGGGACTTTGCATTGG + Intergenic
1032138905 7:129308367-129308389 GTGATTGTGCAACTTTGCATTGG - Intronic
1033499787 7:141936407-141936429 GGGATTGTGAGACTTTACATTGG + Intronic
1033542473 7:142369593-142369615 GTGACTGTGGGACTTTGTGTTGG - Intergenic
1033564979 7:142569679-142569701 GTGATTGTGTGACCCTGCCCAGG + Intergenic
1033814119 7:145051636-145051658 GTGATTGTGGGACTTTACATCGG - Intergenic
1034126287 7:148674838-148674860 GTGATTGTGGGACTTTACATTGG + Intergenic
1034408120 7:150919786-150919808 GTCATTGTGGGAATTTGTATGGG + Intergenic
1035346817 7:158205788-158205810 GTGATAGTGGGACTTGGTATTGG + Intronic
1037373933 8:18208683-18208705 GTTAGTGTGGGATTTTGCATTGG + Intronic
1037701787 8:21282083-21282105 GTGAGTGTAGGACTTTGGACTGG + Intergenic
1038611922 8:29066477-29066499 GTCCTTGTGGGAATGTGCACTGG + Intergenic
1041852352 8:62405553-62405575 GTGATTATGGGACTCTGAATTGG - Intronic
1041883447 8:62779499-62779521 GTGATTGTGAGACTTTGTGTTGG - Intronic
1042984690 8:74570056-74570078 CTGCTTTGGGGACTTTGCACTGG - Intergenic
1043214887 8:77573664-77573686 GTGATTGTGGGAGTTGGCACTGG + Intergenic
1043567204 8:81561651-81561673 GTGATTGTGGGACTTTGCATTGG + Intergenic
1043763137 8:84094922-84094944 GTGAATGTGAAACTTTGCATTGG - Intergenic
1044124168 8:88437354-88437376 GCGATTCTGGGACTTTCCATTGG + Intergenic
1044497326 8:92902371-92902393 GTGATTGTGGGAATTTGCCTTGG - Intronic
1044635549 8:94320193-94320215 GTGATTGCAGGACTTTTCATTGG - Intergenic
1045060894 8:98409942-98409964 TTGATTGTTGGACCTTGGACTGG - Intronic
1045172657 8:99687622-99687644 GTGATTGTGGGACTTGGCATTGG - Intronic
1045440119 8:102201036-102201058 GTGGTTGTGAGAGTTGGCACAGG + Intergenic
1045800547 8:106096399-106096421 GTGATTCTGAGACTTTGCATTGG + Intergenic
1045891901 8:107167407-107167429 GTGACTGTGGGATTTTTCAGAGG + Intergenic
1046031440 8:108787532-108787554 GTGATTGGGGGACTTTCTCCGGG - Exonic
1046215616 8:111141592-111141614 GTGATTATAGGACTTTGCATTGG - Intergenic
1046557193 8:115789953-115789975 GTGGCTGTGGGACTTTGCACTGG + Intronic
1046811541 8:118538546-118538568 GTGATTGTGGGACTTTACATTGG - Intronic
1047342931 8:124000163-124000185 GTGATTGTGGGATTTTGCATTGG - Intronic
1047779321 8:128098554-128098576 CTGGTTGTGTGACCTTGCACAGG + Intergenic
1047938089 8:129801150-129801172 GCGATTGTGAGGCTTTGCATTGG - Intergenic
1048030022 8:130622079-130622101 GGGATTGTGAGACTTCGCATTGG - Intergenic
1048118674 8:131554831-131554853 GTGACTGTGGGACTTTGCTTTGG + Intergenic
1048950532 8:139492938-139492960 ATGAGTGTGGGACTATGCATGGG - Intergenic
1049453561 8:142675572-142675594 GTGAGTGTGGGTGTGTGCACCGG - Intronic
1049882505 8:145075867-145075889 GGGATTGTGCGACTCTGCCCGGG - Intergenic
1050238932 9:3613622-3613644 GGGATTGTGGAACTTTGCATTGG - Intergenic
1050618727 9:7430170-7430192 GTGATTGTGGAAGGTTGCATTGG - Intergenic
1050899379 9:10926579-10926601 GTAACTGTGTGACTTTGCCCAGG + Intergenic
1050907012 9:11016881-11016903 GTGATTGTGGAATATTGCATTGG - Intergenic
1051039218 9:12785653-12785675 GTGATTATGGGACTTTGCATTGG - Intronic
1051229921 9:14945391-14945413 GTGATTATGGGACTTCGCTTTGG + Intergenic
1052093883 9:24361745-24361767 GTGATTGTGGGGCTTTGTATTGG + Intergenic
1052219428 9:26001449-26001471 TTGATTGTGGGCATTTGGACTGG - Intergenic
1052573865 9:30265502-30265524 CTGATTGTGGAACTTTATACTGG - Intergenic
1052666340 9:31499862-31499884 GTGAGTACGGGACTTTGCATTGG + Intergenic
1055191117 9:73525620-73525642 GTGAGTGTTGGATTTTACACAGG - Intergenic
1055694918 9:78873418-78873440 GTGATTTTTGGGCTTTGCAGGGG + Intergenic
1056230692 9:84539716-84539738 GTGATTGTGGGACTTTGCATTGG - Intergenic
1056338704 9:85602865-85602887 GTGACTGTGGGACTTTGCATTGG + Intronic
1057084510 9:92196698-92196720 GTGAGTGTAGGACTTTGCATTGG + Intergenic
1057275149 9:93672374-93672396 GTGAGTGTGGGAGTAGGCACAGG + Intronic
1057275169 9:93672470-93672492 GTGAGTGTGGGAGTAGGCACAGG + Intronic
1058003833 9:99895025-99895047 GTGATTGTGAGACTTTGCATTGG + Intergenic
1058086283 9:100752016-100752038 GTGATTGTGGGACTTTGCATTGG - Intergenic
1058285362 9:103170053-103170075 GTGACTGTGGGACTTTGCATTGG - Intergenic
1058522917 9:105829430-105829452 CTGATTGCAGGACTTTGCATTGG - Intergenic
1058820774 9:108727691-108727713 GTGATTGCTGGACTTTGCATTGG + Intergenic
1059555599 9:115277119-115277141 GTGATTGTGGGACTTTGCACTGG - Intronic
1059838969 9:118191212-118191234 GTGATTGTGGGACTTCACATTGG + Intergenic
1059886568 9:118751092-118751114 GTGATTGTGGGGCTTTGCGTTGG + Intergenic
1060126613 9:121053741-121053763 GTGAGTGTGGGACTTTGCACTGG + Intergenic
1060319448 9:122542747-122542769 TTGACTGTGGTAGTTTGCACAGG - Intergenic
1062743742 9:138197260-138197282 GTGATTGTGCGACTCTGCCTGGG - Intergenic
1203368381 Un_KI270442v1:278572-278594 GTGATTGTTCGACTCTGCCCGGG + Intergenic
1186602259 X:11050291-11050313 GTGATCATGGGACTTTGCATTGG - Intergenic
1186964520 X:14772871-14772893 GTGATTGTGTGACTCTGCCTGGG - Intergenic
1187132594 X:16517175-16517197 ATGATTGTGGGACTTTGCATTGG + Intergenic
1187575124 X:20545983-20546005 GCAATTGTGGGAGTTTGCATTGG - Intergenic
1187636678 X:21237429-21237451 GTGACTGTGGGAGTTTGCATTGG + Intergenic
1187723889 X:22182376-22182398 GTGATTGTGGGACTTTGCACTGG - Intronic
1188071919 X:25727676-25727698 GTGATTATGGGAATTTCCATTGG - Intergenic
1188162000 X:26815400-26815422 GTGATTGTAGGACTTTGCGTTGG - Intergenic
1188421224 X:29992506-29992528 GTAATTGTGGGACTTTACATTGG - Intergenic
1188425095 X:30037081-30037103 GTGATTGTGAGGCTTTGCATTGG - Intergenic
1189412002 X:40780584-40780606 GTGATGGTGGGACTTTGCATTGG - Intergenic
1189628052 X:42920749-42920771 GTGATCGTGGGACTTTTCATTGG + Intergenic
1189640651 X:43067461-43067483 GTGATTGTGGGACTTTGCATTGG + Intergenic
1189854518 X:45210200-45210222 GTGACTGTGGGACTTTGCATTGG - Intergenic
1190122596 X:47674537-47674559 GTGAATGTGGGACTTTGCATTGG - Intergenic
1190498452 X:51051578-51051600 GTGATTATGGGACTTCGCTTTGG + Intergenic
1190507927 X:51145917-51145939 GTGATTGTGGAACTTTGCTTTGG - Intergenic
1190522901 X:51298447-51298469 GTGATTGTGAGACTTTGCATTGG + Intergenic
1190808471 X:53861657-53861679 ATGGTTGTGAAACTTTGCACCGG - Intergenic
1191116847 X:56861358-56861380 GTGACTGTGAAACTTTGCATTGG - Intergenic
1191600116 X:62994101-62994123 GTGAGTGTGGGACTTTACATTGG - Intergenic
1191612063 X:63127570-63127592 GTGATTGTAAGACTTGGCATTGG + Intergenic
1191768916 X:64733563-64733585 GTGATTGTGCTACCTTGCCCAGG - Intergenic
1191813353 X:65216329-65216351 GTGAGTGTGGGACTTCACACTGG + Intergenic
1192069529 X:67922556-67922578 GTGGTTGTGGGACTTTGCATTGG + Intergenic
1192677963 X:73219614-73219636 GTGAGTGTGGGACTTTGCATTGG + Intergenic
1192958902 X:76104959-76104981 GTGATTATGGGTCTTTGCATTGG - Intergenic
1193092433 X:77509637-77509659 GTGATTATGGGACTCTGCATTGG + Intronic
1193335648 X:80285454-80285476 GTGAGTGAGGGACTTTGCCCAGG + Intergenic
1193366830 X:80644343-80644365 GTGATTGTGAGACTTTGCATTGG - Intergenic
1193440953 X:81538659-81538681 GTGATTGTGGGACTTCACATTGG + Intergenic
1193463597 X:81818887-81818909 GTGATTATGAGACTTTGCTTTGG - Intergenic
1193750512 X:85337259-85337281 GTGAGTGTGGGACTTTGCATTGG - Intronic
1193896936 X:87126508-87126530 GTGATTATGGGACTTTGCATTGG + Intergenic
1193931695 X:87561383-87561405 GTGATTGTAGGACTTCACATTGG + Intronic
1194110119 X:89823813-89823835 GTGATTGTGAGACTTTGCATTGG + Intergenic
1194466539 X:94240723-94240745 GTAATTATGGGACTTTGCATTGG - Intergenic
1194507668 X:94752655-94752677 GTGATTGTGGAACTTTGCATTGG - Intergenic
1194877651 X:99208989-99209011 GCAATTGTGGAACTTTGCATTGG - Intergenic
1194884850 X:99301340-99301362 GAGGTTGTGGGGCTTTTCACAGG + Intergenic
1195037257 X:100981361-100981383 GTGATTGTAGGACTTTGGATTGG - Intronic
1195290154 X:103424416-103424438 GTGATTGTGGGACTTTGCATTGG - Intergenic
1195595332 X:106682717-106682739 GTGATTGTGGGACTTTGCATCGG + Intergenic
1196357469 X:114810547-114810569 GTGACTGTGGGACTTTGCATTGG - Intronic
1196368744 X:114951986-114952008 GTGATTGTGGGGCTTTGCATTGG + Intergenic
1196512189 X:116524579-116524601 ATGATTGGAGGACTTTGCATTGG - Intergenic
1196619481 X:117806345-117806367 GTGACTGTGGGACTTGGCATTGG + Intergenic
1197011479 X:121569986-121570008 ATGATTGTGGGACTTTGCATTGG + Intergenic
1197024872 X:121737171-121737193 GTGATTGTGGGAATTTGTTTTGG + Intergenic
1197030594 X:121809180-121809202 GTGAATGTGGGACTTTGTATTGG - Intergenic
1197053803 X:122093489-122093511 GCGATTGTGGGAGTTTGCATTGG + Intergenic
1197104910 X:122702519-122702541 GTGAGTGTGGAAATTTGCATTGG + Intergenic
1197177966 X:123504792-123504814 GTGATTTGGGGACTTTTCATTGG + Intergenic
1197361241 X:125505579-125505601 GTCATTGTGGAACTTTGCATTGG - Intergenic
1197380932 X:125737519-125737541 TTGATTGTAGGACTTTGCATTGG - Intergenic
1197382863 X:125766435-125766457 GTGATTGTGAGATATTGCATTGG - Intergenic
1197439221 X:126470293-126470315 GTGATTGTGGGTCTTTATATTGG + Intergenic
1197670701 X:129273786-129273808 GTGATTGTGGGACTTTACATTGG - Intergenic
1197953035 X:131918412-131918434 GCAACTGTGGGACTTTGCATTGG + Intergenic
1198686995 X:139237703-139237725 GTGATTGTGTGACCTTGCCTGGG + Intergenic
1198761562 X:140038357-140038379 GTGACTGTGGGACTTTGTATTGG + Intergenic
1198947673 X:142032220-142032242 GTGATTGTAGGACTTTGTGTTGG - Intergenic
1199457508 X:148045018-148045040 GTGGTTGTGGGACTATGCATTGG - Intergenic
1199464454 X:148120327-148120349 GTGATTGTGGGACTTTGCACTGG + Intergenic
1199614368 X:149645071-149645093 GTGATTCTGGGCCATTCCACTGG + Intergenic
1199795397 X:151191076-151191098 GTGATTGCGGGACTTTGCATTGG + Intergenic
1199816416 X:151401793-151401815 GTGATTGGGGCACTTTACTCTGG - Intronic
1199962821 X:152791785-152791807 GTGATTGTGGGACTTTGCGTTGG + Intergenic
1200177209 X:154125545-154125567 GTGACTGTGGGGCTTTGCGTCGG + Intergenic
1200462778 Y:3478554-3478576 GTGATTGTGAGACTTTGCATTGG + Intergenic
1201070318 Y:10141730-10141752 GTGATTGTGTGACTCTGCCCGGG - Intergenic