ID: 1116358139

View in Genome Browser
Species Human (GRCh38)
Location 14:43957401-43957423
Sequence GTTTAAGAAGCTTTTGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116358139_1116358143 5 Left 1116358139 14:43957401-43957423 CCGGCCCCAAAAGCTTCTTAAAC No data
Right 1116358143 14:43957429-43957451 AACAAATTCAGCAAAGTCTCAGG 0: 8
1: 787
2: 12276
3: 6966
4: 4791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116358139 Original CRISPR GTTTAAGAAGCTTTTGGGGC CGG (reversed) Intergenic
No off target data available for this crispr