ID: 1116360585

View in Genome Browser
Species Human (GRCh38)
Location 14:43991605-43991627
Sequence CTGTAGTCACAGAGTGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116360583_1116360585 -3 Left 1116360583 14:43991585-43991607 CCTCTTAAATTATTTGCAAACTG No data
Right 1116360585 14:43991605-43991627 CTGTAGTCACAGAGTGTGGTAGG No data
1116360582_1116360585 -2 Left 1116360582 14:43991584-43991606 CCCTCTTAAATTATTTGCAAACT No data
Right 1116360585 14:43991605-43991627 CTGTAGTCACAGAGTGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116360585 Original CRISPR CTGTAGTCACAGAGTGTGGT AGG Intergenic
No off target data available for this crispr