ID: 1116361898

View in Genome Browser
Species Human (GRCh38)
Location 14:44010139-44010161
Sequence GCAGTCTGGAAAAATAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116361898_1116361901 -3 Left 1116361898 14:44010139-44010161 CCTGAGTTATTTTTCCAGACTGC No data
Right 1116361901 14:44010159-44010181 TGCTTTAGTGAAGGACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116361898 Original CRISPR GCAGTCTGGAAAAATAACTC AGG (reversed) Intergenic
No off target data available for this crispr