ID: 1116363200

View in Genome Browser
Species Human (GRCh38)
Location 14:44027699-44027721
Sequence GCAATCATTAAGTTTAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116363200_1116363205 11 Left 1116363200 14:44027699-44027721 CCTTATTTAAACTTAATGATTGC No data
Right 1116363205 14:44027733-44027755 TATATCTAATATAATTCCATTGG No data
1116363200_1116363206 19 Left 1116363200 14:44027699-44027721 CCTTATTTAAACTTAATGATTGC No data
Right 1116363206 14:44027741-44027763 ATATAATTCCATTGGAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116363200 Original CRISPR GCAATCATTAAGTTTAAATA AGG (reversed) Intergenic
No off target data available for this crispr