ID: 1116366353

View in Genome Browser
Species Human (GRCh38)
Location 14:44070270-44070292
Sequence ATAAGCTAGCAGTCCCACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116366353_1116366357 12 Left 1116366353 14:44070270-44070292 CCCAAGTGGGACTGCTAGCTTAT No data
Right 1116366357 14:44070305-44070327 CTGTCATGGAACCAAACTTCAGG No data
1116366353_1116366355 -2 Left 1116366353 14:44070270-44070292 CCCAAGTGGGACTGCTAGCTTAT No data
Right 1116366355 14:44070291-44070313 ATGTCGATTACCAGCTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116366353 Original CRISPR ATAAGCTAGCAGTCCCACTT GGG (reversed) Intergenic
No off target data available for this crispr