ID: 1116369224

View in Genome Browser
Species Human (GRCh38)
Location 14:44108766-44108788
Sequence CTTTAACACATGTGCAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116369219_1116369224 8 Left 1116369219 14:44108735-44108757 CCTAAACATGCCCATGATGAAAA No data
Right 1116369224 14:44108766-44108788 CTTTAACACATGTGCAGCAAGGG No data
1116369220_1116369224 -2 Left 1116369220 14:44108745-44108767 CCCATGATGAAAAATCTCATCCT No data
Right 1116369224 14:44108766-44108788 CTTTAACACATGTGCAGCAAGGG No data
1116369221_1116369224 -3 Left 1116369221 14:44108746-44108768 CCATGATGAAAAATCTCATCCTT No data
Right 1116369224 14:44108766-44108788 CTTTAACACATGTGCAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116369224 Original CRISPR CTTTAACACATGTGCAGCAA GGG Intergenic
No off target data available for this crispr