ID: 1116372542

View in Genome Browser
Species Human (GRCh38)
Location 14:44154559-44154581
Sequence GAGCAAGACTTGCACTTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116372542_1116372545 -4 Left 1116372542 14:44154559-44154581 CCAACTAAGTGCAAGTCTTGCTC No data
Right 1116372545 14:44154578-44154600 GCTCCATGGCCCAAGGCTCCAGG No data
1116372542_1116372550 10 Left 1116372542 14:44154559-44154581 CCAACTAAGTGCAAGTCTTGCTC No data
Right 1116372550 14:44154592-44154614 GGCTCCAGGTTGGCCCCTGTAGG No data
1116372542_1116372552 16 Left 1116372542 14:44154559-44154581 CCAACTAAGTGCAAGTCTTGCTC No data
Right 1116372552 14:44154598-44154620 AGGTTGGCCCCTGTAGGACCAGG No data
1116372542_1116372547 0 Left 1116372542 14:44154559-44154581 CCAACTAAGTGCAAGTCTTGCTC No data
Right 1116372547 14:44154582-44154604 CATGGCCCAAGGCTCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116372542 Original CRISPR GAGCAAGACTTGCACTTAGT TGG (reversed) Intergenic
No off target data available for this crispr