ID: 1116372552

View in Genome Browser
Species Human (GRCh38)
Location 14:44154598-44154620
Sequence AGGTTGGCCCCTGTAGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116372542_1116372552 16 Left 1116372542 14:44154559-44154581 CCAACTAAGTGCAAGTCTTGCTC No data
Right 1116372552 14:44154598-44154620 AGGTTGGCCCCTGTAGGACCAGG No data
1116372546_1116372552 -6 Left 1116372546 14:44154581-44154603 CCATGGCCCAAGGCTCCAGGTTG No data
Right 1116372552 14:44154598-44154620 AGGTTGGCCCCTGTAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116372552 Original CRISPR AGGTTGGCCCCTGTAGGACC AGG Intergenic
No off target data available for this crispr