ID: 1116377215

View in Genome Browser
Species Human (GRCh38)
Location 14:44218167-44218189
Sequence TAAATTAGTTCAGCCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116377213_1116377215 -8 Left 1116377213 14:44218152-44218174 CCACTGGTGGGAGTATAAATTAG No data
Right 1116377215 14:44218167-44218189 TAAATTAGTTCAGCCAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116377215 Original CRISPR TAAATTAGTTCAGCCAGTGT GGG Intergenic
No off target data available for this crispr