ID: 1116377301

View in Genome Browser
Species Human (GRCh38)
Location 14:44219513-44219535
Sequence TAATTAGTAGGTCTGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116377299_1116377301 20 Left 1116377299 14:44219470-44219492 CCTGCTTAAAATCTGAGGAATGC No data
Right 1116377301 14:44219513-44219535 TAATTAGTAGGTCTGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116377301 Original CRISPR TAATTAGTAGGTCTGATCAA AGG Intergenic
No off target data available for this crispr