ID: 1116381857

View in Genome Browser
Species Human (GRCh38)
Location 14:44278773-44278795
Sequence CAAAATAAGTAAATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116381857_1116381863 -9 Left 1116381857 14:44278773-44278795 CCAGCCTCCATTTACTTATTTTG No data
Right 1116381863 14:44278787-44278809 CTTATTTTGTACAGGGATCAGGG No data
1116381857_1116381864 3 Left 1116381857 14:44278773-44278795 CCAGCCTCCATTTACTTATTTTG No data
Right 1116381864 14:44278799-44278821 AGGGATCAGGGAAAGAAGTGAGG No data
1116381857_1116381862 -10 Left 1116381857 14:44278773-44278795 CCAGCCTCCATTTACTTATTTTG No data
Right 1116381862 14:44278786-44278808 ACTTATTTTGTACAGGGATCAGG No data
1116381857_1116381866 9 Left 1116381857 14:44278773-44278795 CCAGCCTCCATTTACTTATTTTG No data
Right 1116381866 14:44278805-44278827 CAGGGAAAGAAGTGAGGTCAGGG No data
1116381857_1116381867 10 Left 1116381857 14:44278773-44278795 CCAGCCTCCATTTACTTATTTTG No data
Right 1116381867 14:44278806-44278828 AGGGAAAGAAGTGAGGTCAGGGG No data
1116381857_1116381865 8 Left 1116381857 14:44278773-44278795 CCAGCCTCCATTTACTTATTTTG No data
Right 1116381865 14:44278804-44278826 TCAGGGAAAGAAGTGAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116381857 Original CRISPR CAAAATAAGTAAATGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr