ID: 1116392267

View in Genome Browser
Species Human (GRCh38)
Location 14:44407257-44407279
Sequence CCCTTAGGGTAATAGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116392267_1116392273 -2 Left 1116392267 14:44407257-44407279 CCTGGTGGCTATTACCCTAAGGG No data
Right 1116392273 14:44407278-44407300 GGAAATAAGCCAGGCATGGAAGG No data
1116392267_1116392272 -6 Left 1116392267 14:44407257-44407279 CCTGGTGGCTATTACCCTAAGGG No data
Right 1116392272 14:44407274-44407296 TAAGGGAAATAAGCCAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116392267 Original CRISPR CCCTTAGGGTAATAGCCACC AGG (reversed) Intergenic
No off target data available for this crispr