ID: 1116396081

View in Genome Browser
Species Human (GRCh38)
Location 14:44449933-44449955
Sequence GGAAAGTTGTTTACTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116396077_1116396081 14 Left 1116396077 14:44449896-44449918 CCAGGGAACAGATGTGAACTACT 0: 7
1: 7
2: 5
3: 16
4: 132
Right 1116396081 14:44449933-44449955 GGAAAGTTGTTTACTGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116396081 Original CRISPR GGAAAGTTGTTTACTGAAAC TGG Intergenic
No off target data available for this crispr