ID: 1116401306

View in Genome Browser
Species Human (GRCh38)
Location 14:44510911-44510933
Sequence ATGAGTTCATGACCTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116401306_1116401309 4 Left 1116401306 14:44510911-44510933 CCCTGCAGAGGTCATGAACTCAT No data
Right 1116401309 14:44510938-44510960 TTTTATGACTGCATATTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116401306 Original CRISPR ATGAGTTCATGACCTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr