ID: 1116409715

View in Genome Browser
Species Human (GRCh38)
Location 14:44607134-44607156
Sequence GCCACAGGGCTGCTGAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116409715_1116409721 12 Left 1116409715 14:44607134-44607156 CCATAGCTCAGCAGCCCTGTGGC No data
Right 1116409721 14:44607169-44607191 TTACATATGTACTCTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116409715 Original CRISPR GCCACAGGGCTGCTGAGCTA TGG (reversed) Intergenic
No off target data available for this crispr