ID: 1116409721

View in Genome Browser
Species Human (GRCh38)
Location 14:44607169-44607191
Sequence TTACATATGTACTCTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116409717_1116409721 -3 Left 1116409717 14:44607149-44607171 CCTGTGGCATTTTCCCCATGTTA No data
Right 1116409721 14:44607169-44607191 TTACATATGTACTCTGTGTCTGG No data
1116409715_1116409721 12 Left 1116409715 14:44607134-44607156 CCATAGCTCAGCAGCCCTGTGGC No data
Right 1116409721 14:44607169-44607191 TTACATATGTACTCTGTGTCTGG No data
1116409713_1116409721 25 Left 1116409713 14:44607121-44607143 CCTGCTACTGGGTCCATAGCTCA No data
Right 1116409721 14:44607169-44607191 TTACATATGTACTCTGTGTCTGG No data
1116409716_1116409721 -2 Left 1116409716 14:44607148-44607170 CCCTGTGGCATTTTCCCCATGTT No data
Right 1116409721 14:44607169-44607191 TTACATATGTACTCTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116409721 Original CRISPR TTACATATGTACTCTGTGTC TGG Intergenic
No off target data available for this crispr