ID: 1116411240

View in Genome Browser
Species Human (GRCh38)
Location 14:44626202-44626224
Sequence TACACCTGGCATAAAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116411236_1116411240 30 Left 1116411236 14:44626149-44626171 CCATAGACTGCAGAAGGGAGAGG No data
Right 1116411240 14:44626202-44626224 TACACCTGGCATAAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116411240 Original CRISPR TACACCTGGCATAAAATTTC AGG Intergenic
No off target data available for this crispr