ID: 1116415069

View in Genome Browser
Species Human (GRCh38)
Location 14:44669285-44669307
Sequence AGTTATTTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116415069_1116415071 2 Left 1116415069 14:44669285-44669307 CCTGCCATCTTCTGCAAATAACT No data
Right 1116415071 14:44669310-44669332 TCTCCTTCTGAGAGACAACTCGG No data
1116415069_1116415074 14 Left 1116415069 14:44669285-44669307 CCTGCCATCTTCTGCAAATAACT No data
Right 1116415074 14:44669322-44669344 AGACAACTCGGCCTGTTGCTGGG No data
1116415069_1116415073 13 Left 1116415069 14:44669285-44669307 CCTGCCATCTTCTGCAAATAACT No data
Right 1116415073 14:44669321-44669343 GAGACAACTCGGCCTGTTGCTGG No data
1116415069_1116415075 23 Left 1116415069 14:44669285-44669307 CCTGCCATCTTCTGCAAATAACT No data
Right 1116415075 14:44669331-44669353 GGCCTGTTGCTGGGCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116415069 Original CRISPR AGTTATTTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr