ID: 1116415071

View in Genome Browser
Species Human (GRCh38)
Location 14:44669310-44669332
Sequence TCTCCTTCTGAGAGACAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116415067_1116415071 25 Left 1116415067 14:44669262-44669284 CCTCTAGGAATTTGGAGCAAGTC No data
Right 1116415071 14:44669310-44669332 TCTCCTTCTGAGAGACAACTCGG No data
1116415068_1116415071 3 Left 1116415068 14:44669284-44669306 CCCTGCCATCTTCTGCAAATAAC No data
Right 1116415071 14:44669310-44669332 TCTCCTTCTGAGAGACAACTCGG No data
1116415069_1116415071 2 Left 1116415069 14:44669285-44669307 CCTGCCATCTTCTGCAAATAACT No data
Right 1116415071 14:44669310-44669332 TCTCCTTCTGAGAGACAACTCGG No data
1116415070_1116415071 -2 Left 1116415070 14:44669289-44669311 CCATCTTCTGCAAATAACTACTC 0: 11
1: 189
2: 190
3: 139
4: 322
Right 1116415071 14:44669310-44669332 TCTCCTTCTGAGAGACAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116415071 Original CRISPR TCTCCTTCTGAGAGACAACT CGG Intergenic
No off target data available for this crispr