ID: 1116415074

View in Genome Browser
Species Human (GRCh38)
Location 14:44669322-44669344
Sequence AGACAACTCGGCCTGTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116415068_1116415074 15 Left 1116415068 14:44669284-44669306 CCCTGCCATCTTCTGCAAATAAC No data
Right 1116415074 14:44669322-44669344 AGACAACTCGGCCTGTTGCTGGG No data
1116415069_1116415074 14 Left 1116415069 14:44669285-44669307 CCTGCCATCTTCTGCAAATAACT No data
Right 1116415074 14:44669322-44669344 AGACAACTCGGCCTGTTGCTGGG No data
1116415070_1116415074 10 Left 1116415070 14:44669289-44669311 CCATCTTCTGCAAATAACTACTC 0: 11
1: 189
2: 190
3: 139
4: 322
Right 1116415074 14:44669322-44669344 AGACAACTCGGCCTGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116415074 Original CRISPR AGACAACTCGGCCTGTTGCT GGG Intergenic
No off target data available for this crispr