ID: 1116418028

View in Genome Browser
Species Human (GRCh38)
Location 14:44701665-44701687
Sequence CTAGTCTAAGATGACTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116418026_1116418028 -4 Left 1116418026 14:44701646-44701668 CCAGGTGTCTGGGGGCTGCCTAG No data
Right 1116418028 14:44701665-44701687 CTAGTCTAAGATGACTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116418028 Original CRISPR CTAGTCTAAGATGACTCAGC AGG Intergenic
No off target data available for this crispr