ID: 1116421290

View in Genome Browser
Species Human (GRCh38)
Location 14:44735741-44735763
Sequence TACTGGGTGCTGTAAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116421290_1116421293 -2 Left 1116421290 14:44735741-44735763 CCATTGTCTTACAGCACCCAGTA No data
Right 1116421293 14:44735762-44735784 TATCACTAATGAGAAATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116421290 Original CRISPR TACTGGGTGCTGTAAGACAA TGG (reversed) Intergenic
No off target data available for this crispr