ID: 1116425601

View in Genome Browser
Species Human (GRCh38)
Location 14:44786612-44786634
Sequence GTGGCCTGCTCTATATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116425601_1116425608 24 Left 1116425601 14:44786612-44786634 CCATGGGATATAGAGCAGGCCAC No data
Right 1116425608 14:44786659-44786681 TTGGAGAAGCTTCAGAAAAAGGG No data
1116425601_1116425605 -2 Left 1116425601 14:44786612-44786634 CCATGGGATATAGAGCAGGCCAC No data
Right 1116425605 14:44786633-44786655 ACTGCTTGGATGTGAAAGCTGGG No data
1116425601_1116425604 -3 Left 1116425601 14:44786612-44786634 CCATGGGATATAGAGCAGGCCAC No data
Right 1116425604 14:44786632-44786654 CACTGCTTGGATGTGAAAGCTGG No data
1116425601_1116425607 23 Left 1116425601 14:44786612-44786634 CCATGGGATATAGAGCAGGCCAC No data
Right 1116425607 14:44786658-44786680 TTTGGAGAAGCTTCAGAAAAAGG No data
1116425601_1116425606 5 Left 1116425601 14:44786612-44786634 CCATGGGATATAGAGCAGGCCAC No data
Right 1116425606 14:44786640-44786662 GGATGTGAAAGCTGGGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116425601 Original CRISPR GTGGCCTGCTCTATATCCCA TGG (reversed) Intergenic
No off target data available for this crispr