ID: 1116427611

View in Genome Browser
Species Human (GRCh38)
Location 14:44809650-44809672
Sequence GGGGGCATTCACCTTTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116427611_1116427617 -4 Left 1116427611 14:44809650-44809672 CCACTCTAAAGGTGAATGCCCCC No data
Right 1116427617 14:44809669-44809691 CCCCTTCCTTCCTGGGGTCAAGG No data
1116427611_1116427614 -10 Left 1116427611 14:44809650-44809672 CCACTCTAAAGGTGAATGCCCCC No data
Right 1116427614 14:44809663-44809685 GAATGCCCCCTTCCTTCCTGGGG No data
1116427611_1116427620 -1 Left 1116427611 14:44809650-44809672 CCACTCTAAAGGTGAATGCCCCC No data
Right 1116427620 14:44809672-44809694 CTTCCTTCCTGGGGTCAAGGAGG No data
1116427611_1116427623 7 Left 1116427611 14:44809650-44809672 CCACTCTAAAGGTGAATGCCCCC No data
Right 1116427623 14:44809680-44809702 CTGGGGTCAAGGAGGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116427611 Original CRISPR GGGGGCATTCACCTTTAGAG TGG (reversed) Intergenic
No off target data available for this crispr