ID: 1116429322

View in Genome Browser
Species Human (GRCh38)
Location 14:44827752-44827774
Sequence CTCCATTCACATATGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116429322_1116429323 -1 Left 1116429322 14:44827752-44827774 CCTTGCTTCATATGTGAATGGAG No data
Right 1116429323 14:44827774-44827796 GTTCAAATATCATGAACGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116429322 Original CRISPR CTCCATTCACATATGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr