ID: 1116429540

View in Genome Browser
Species Human (GRCh38)
Location 14:44830015-44830037
Sequence CTAAAATGCCTGGCAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116429540_1116429543 18 Left 1116429540 14:44830015-44830037 CCTATTTTTGCCAGGCATTTTAG No data
Right 1116429543 14:44830056-44830078 GCATAAATCTAAAAATCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116429540 Original CRISPR CTAAAATGCCTGGCAAAAAT AGG (reversed) Intergenic
No off target data available for this crispr