ID: 1116432469

View in Genome Browser
Species Human (GRCh38)
Location 14:44862736-44862758
Sequence TACTCCTTGTAGAACTCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116432468_1116432469 1 Left 1116432468 14:44862712-44862734 CCAGGCGGTTATACTGGGATACG 0: 1
1: 1
2: 0
3: 0
4: 7
Right 1116432469 14:44862736-44862758 TACTCCTTGTAGAACTCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116432469 Original CRISPR TACTCCTTGTAGAACTCTGT CGG Intergenic
No off target data available for this crispr