ID: 1116443038

View in Genome Browser
Species Human (GRCh38)
Location 14:44976475-44976497
Sequence CAATGTGCTCAGAGTATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116443038_1116443041 30 Left 1116443038 14:44976475-44976497 CCCACTATACTCTGAGCACATTG 0: 1
1: 1
2: 2
3: 24
4: 303
Right 1116443041 14:44976528-44976550 AGTATCTTTAGCACAGTGCTTGG 0: 1
1: 1
2: 3
3: 40
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116443038 Original CRISPR CAATGTGCTCAGAGTATAGT GGG (reversed) Intronic
900044731 1:496362-496384 CAAAGTGCTAAGATTATAGCTGG + Intergenic
900066135 1:731268-731290 CAAAGTGCTAAGATTATAGCTGG + Intergenic
900066530 1:734676-734698 CAAAGTGCTAAGATTATAGCTGG + Intergenic
900066926 1:738083-738105 CAAAGTGCTAAGATTATAGCTGG + Intergenic
901605693 1:10457409-10457431 CAAAGTGCTGGGAGTATAGGTGG - Exonic
901731786 1:11285330-11285352 CATTGAACTAAGAGTATAGTGGG + Intronic
904958396 1:34308684-34308706 CTGTGTGCTCAGAGTGTGGTTGG - Intergenic
905312007 1:37055847-37055869 CAGGGTGCTCAGAGCACAGTAGG - Intergenic
905554018 1:38867700-38867722 CAATGTGCTCAGCGTATAGTTGG - Intronic
906039637 1:42778283-42778305 CAGGGAGCTCACAGTATAGTAGG + Intronic
906245857 1:44273614-44273636 CAGTGAACTCACAGTATAGTGGG + Intronic
906547688 1:46632842-46632864 CAAGGAGCTCACAGTCTAGTGGG + Exonic
906948003 1:50311917-50311939 CACAGTGTTCAGTGTATAGTAGG + Intergenic
907113254 1:51946672-51946694 CAAAGTGCTCAGAACATAGTGGG - Intronic
907377810 1:54058411-54058433 CAAGAAGCTCAGAGTATAGCGGG - Intronic
908605234 1:65791672-65791694 CAAAGTGCTCAGTGCACAGTAGG + Intergenic
908712243 1:67029319-67029341 CAAAGTGATCAGAAAATAGTAGG + Intronic
908746540 1:67382118-67382140 CAAAGTGCTGAGATTATAGGTGG - Intronic
908851105 1:68376600-68376622 CCAAGTGCTCTGTGTATAGTGGG + Intergenic
910536824 1:88307726-88307748 CAATGTGCTAAGCACATAGTAGG - Intergenic
912728545 1:112080702-112080724 CAAAGTGCCCAGAACATAGTAGG + Intergenic
912902652 1:113669319-113669341 CAAGGAGTTCAGAGTCTAGTAGG + Intronic
914451683 1:147798372-147798394 CACAGTGCTCAGAGGATAGTTGG - Intergenic
916173274 1:162017822-162017844 CAAGGAGCTCACAGTCTAGTAGG - Intronic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
918649085 1:186937910-186937932 CACAGTGCCCAGAATATAGTAGG + Intronic
919195681 1:194282346-194282368 CAATGTGTTAAGTGTATATTTGG - Intergenic
921372512 1:214438869-214438891 CATTGTGCTTAGCATATAGTAGG - Intronic
921403394 1:214751909-214751931 CAAAGTGCTGGGATTATAGTAGG + Intergenic
921704406 1:218305306-218305328 TAATGTGCTAAGTGTATATTTGG + Intronic
922101253 1:222478617-222478639 CAAAGTGCTAAGATTATAGCTGG + Intergenic
922234836 1:223714763-223714785 CATTGTGCCCAGCATATAGTAGG - Intronic
922733364 1:227966042-227966064 CAAAGTGCTAAGATTATAGCTGG - Intergenic
923888946 1:238189710-238189732 CAAAGAGCTCAGAGTCTAATGGG - Intergenic
924101999 1:240613379-240613401 CAATGTGCTGTGAGTTGAGTTGG - Intergenic
924344177 1:243058734-243058756 CAAAGTGCTAAGATTATAGCTGG + Intergenic
1063221618 10:3974329-3974351 CAATGAGCTGAGAGAATAGAAGG - Intergenic
1064361093 10:14665460-14665482 AAATGTTCTCAGAACATAGTGGG + Intronic
1065705442 10:28467922-28467944 CAGTGGGCTCAGATGATAGTGGG - Intergenic
1066335172 10:34469368-34469390 CAAAGTGCTGAGATTATAGGTGG + Intronic
1066538252 10:36414810-36414832 CTATGGTCTCAGAGTGTAGTTGG + Intergenic
1066732159 10:38446333-38446355 CAAAGTGCTAAGATTATAGCTGG - Intergenic
1068167336 10:53347837-53347859 CAGTGTGCTCAGAGTTTGGTGGG + Intergenic
1069008951 10:63349498-63349520 CAAAGTGCTTATAGAATAGTAGG + Intronic
1069189835 10:65473102-65473124 CAAAGTGCTCATAGCAGAGTAGG - Intergenic
1069650010 10:70039973-70039995 CAAAGTGCCCAGATTATAGGTGG - Intergenic
1070338378 10:75474965-75474987 CAATGAACACAGAGTATGGTGGG - Intronic
1071562728 10:86656216-86656238 CACTGTGCCCAGGGTATAGTGGG - Exonic
1072133736 10:92522964-92522986 CAAGGTGCTGAAAGTTTAGTTGG - Intronic
1072719688 10:97772714-97772736 CAATGTGCTCAGATCAGACTTGG - Intergenic
1073285916 10:102388131-102388153 TAGTGAGCTCAGAGTTTAGTAGG + Intergenic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1075530166 10:123222348-123222370 GAATTTGCACAGAGCATAGTGGG + Intergenic
1076971056 11:132837-132859 CAAAGTGCTAAGATTATAGCTGG + Intergenic
1077858360 11:6152009-6152031 CAATGTGCTCACAGTATGAGTGG + Intergenic
1078453904 11:11460390-11460412 CATTTTGCTCAGAGTAGTGTTGG - Intronic
1080101108 11:28460645-28460667 CAAGGAGCTCAGAGTATAGTAGG + Intergenic
1081034788 11:38129983-38130005 AAATGATCTCAGACTATAGTGGG + Intergenic
1081655466 11:44854275-44854297 CAAAGTGCTCATTGTATGGTGGG - Intronic
1082018253 11:47509028-47509050 CAATGTGCTGGGATTATAGGGGG + Intronic
1083311351 11:61785505-61785527 TGATGTGCCCAGAGCATAGTGGG + Intronic
1085107434 11:73857539-73857561 CAAAGTGCTCACATTATAGGTGG + Intronic
1085558298 11:77445918-77445940 GAATGTGCTTATTGTATAGTGGG - Intronic
1086044435 11:82516454-82516476 CAATGTGCTCAGCTTACATTTGG - Intergenic
1089795622 11:120978203-120978225 CAAAGAGCTCACAGTGTAGTGGG + Intronic
1090067390 11:123514860-123514882 CAAGGAGCTCACAGTCTAGTGGG - Intergenic
1090793486 11:130113114-130113136 CAAGGTGTTCACAGCATAGTTGG - Intronic
1091542202 12:1472385-1472407 CAAAGTGCTGGGATTATAGTGGG - Intronic
1091740572 12:2958574-2958596 CAAAGAGCTCAGAGTTTAGCTGG - Intergenic
1091882028 12:3987333-3987355 GAATATACTTAGAGTATAGTTGG - Intergenic
1092083245 12:5735433-5735455 GAAAGAGCTCAGAGTATAGCAGG - Intronic
1092794231 12:12094328-12094350 CAAAGGGCTCACAGTCTAGTGGG - Intronic
1095477470 12:42600529-42600551 CATTGTGCTCAGCATACAGTAGG - Intergenic
1096800072 12:54104666-54104688 CATGGTGCTCACAGTCTAGTGGG - Intergenic
1098310032 12:69139403-69139425 CAAGGGGCTCAGAATTTAGTTGG + Intergenic
1099772960 12:87086687-87086709 CAAAGTGCTAGGAGTACAGTGGG + Intergenic
1100673767 12:96844770-96844792 GAAGGAGCTTAGAGTATAGTTGG - Intronic
1101907891 12:108841384-108841406 AATTTTGCTCAGAGTCTAGTAGG - Intronic
1101954816 12:109203844-109203866 CACAGTGCTCGGAGCATAGTGGG + Intronic
1103615809 12:122151295-122151317 CAAAGTGCTGAGATTATAGGTGG - Intergenic
1105027788 12:132861012-132861034 CAAAGTGCTGAGATTATAGGCGG + Intronic
1105586110 13:21744427-21744449 CAAGGAGCTCACAGTCTAGTAGG + Intergenic
1105782808 13:23719277-23719299 CAATTTGCCCACAGTTTAGTGGG + Intergenic
1106201100 13:27538071-27538093 CAAAGTGCTAAGATTACAGTTGG - Intergenic
1106201320 13:27539529-27539551 CAAAGTGCTAAGATTACAGTTGG + Intergenic
1107085304 13:36421126-36421148 CATAGTGCTCAGAACATAGTAGG - Intergenic
1107550781 13:41473022-41473044 TAATGGGCACAAAGTATAGTTGG - Intergenic
1108059918 13:46522344-46522366 CAATGTGCTCAGCACATAGTTGG + Intergenic
1109769690 13:66954651-66954673 CTTTGTGCCCAGAGCATAGTTGG - Intronic
1110104374 13:71652756-71652778 CAAGGAGCTCATAGTATAATTGG - Intronic
1110688976 13:78409297-78409319 TAAGGTGCTGAGAGTATAGTGGG - Intergenic
1110732261 13:78892457-78892479 CACTGTGTTCAGTGCATAGTAGG + Intergenic
1111754619 13:92377243-92377265 CAAGGGGCTCACAGTATAGTAGG - Intronic
1111800874 13:92978941-92978963 CAATAATTTCAGAGTATAGTGGG + Intergenic
1113044102 13:106135791-106135813 CAATATGCTCAATGTATAATGGG + Intergenic
1113387343 13:109860965-109860987 CAAAGAGCTCAGAGTCTAGCAGG - Intergenic
1113588778 13:111483631-111483653 CAATGTGCCCAGCACATAGTAGG + Intergenic
1113757380 13:112822623-112822645 CAAAGTGCTGAGATTACAGTTGG - Intronic
1114812266 14:25914695-25914717 AAGTGTGGGCAGAGTATAGTGGG - Intergenic
1115170654 14:30502284-30502306 CAAAGTGGTCAAAGCATAGTTGG - Intergenic
1115983841 14:39083481-39083503 CAAGGTGGTCAGAGCACAGTTGG - Intronic
1116443038 14:44976475-44976497 CAATGTGCTCAGAGTATAGTGGG - Intronic
1117168981 14:53070675-53070697 AAATGTGCTCAGAAAATATTTGG + Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121991178 14:98559196-98559218 CTGTGTGCTCAGAGAAAAGTGGG + Intergenic
1122480688 14:102045347-102045369 CAAAGTGCTGGGATTATAGTGGG - Intronic
1125167567 15:36726287-36726309 GAATGTGCTCAGCTGATAGTGGG - Intronic
1128750408 15:70144635-70144657 CTACGTGCTCACAGGATAGTTGG - Intergenic
1130245108 15:82239946-82239968 CAAGGAGCTCACAGTATAGTAGG - Intronic
1130455567 15:84103464-84103486 CAAGGAGCTCACAGTATAGTAGG + Intergenic
1130542464 15:84830973-84830995 CAAAGTGCTGGGATTATAGTAGG + Intronic
1130969418 15:88720576-88720598 AAATGTTTTCAGAGTATATTGGG - Intergenic
1131490371 15:92857448-92857470 CAAAGTGCTCAGAGTCTAGTTGG + Intergenic
1132422672 15:101686896-101686918 AAATGTGCTCAAAGTATACATGG - Intronic
1133086511 16:3368230-3368252 CTAGGTGCTCAGAATATTGTGGG + Intronic
1133820856 16:9235311-9235333 CAAGGTGGTCAGAGCACAGTTGG + Intergenic
1134198874 16:12181283-12181305 CAAGGTGGTCAGAGCATGGTTGG + Intronic
1135199903 16:20428369-20428391 GCATGTGCTCAGAGAACAGTTGG - Intronic
1135218798 16:20595241-20595263 ACATGTGCTCAGAGAACAGTTGG + Intergenic
1135861956 16:26064337-26064359 CAAGGTGCTTAGGGTATAGAGGG + Intronic
1138160828 16:54752275-54752297 CAATGTGTTCAGAGAGTAATTGG + Intergenic
1142449193 16:90164681-90164703 CAAAGTGCTAAGATTATAGCTGG - Intergenic
1142457902 17:67200-67222 CAAAGTGCTAAGATTATAGCTGG + Intergenic
1142458295 17:70620-70642 CAAAGTGCTAAGATTATAGCTGG + Intergenic
1145758397 17:27409484-27409506 CAAGGTGCTCACAGTTTAGGGGG + Intergenic
1145965650 17:28914971-28914993 CAAGGAGCTCACAGTCTAGTGGG + Intronic
1146513661 17:33472358-33472380 CAATGTGCCCAGTGCATGGTGGG - Intronic
1147783353 17:42960007-42960029 CAATGTGCTGAGATTACAGGCGG - Intronic
1148732224 17:49844343-49844365 CAACGTGCTCAGAACATAGTAGG - Intronic
1151422721 17:74008978-74009000 CACTGTGCTGAGTGCATAGTAGG - Intergenic
1155630819 18:27890054-27890076 CAAGGTGCTCAGAGTCAAATAGG - Intergenic
1157714348 18:49873008-49873030 CAAGGTGCTTAGAGTTTAGTTGG - Intronic
1158415574 18:57247179-57247201 CCATGTGCTCAGCATATATTAGG - Intergenic
1158422362 18:57306504-57306526 CATGATGCTCAGAGTACAGTGGG - Intergenic
1158875211 18:61727254-61727276 CAAGTTGCTCATAGTCTAGTGGG - Intergenic
1159013761 18:63084179-63084201 CTATGTGCTCAAAGTCTAGATGG - Intergenic
1159764805 18:72475739-72475761 CAAAGTGCTCAGACTACAGTGGG + Intergenic
1160648013 19:203126-203148 CAAAGTGCTAAGATTATAGCTGG + Intergenic
1161562195 19:4979600-4979622 CGAGGAGCTCAGAGTCTAGTTGG + Intronic
1161691559 19:5737937-5737959 CCATGGGCTCAGAGCACAGTTGG + Intronic
1164290393 19:23863300-23863322 CAATGTGCTGAGATTACAGGTGG - Intergenic
1167288013 19:48609799-48609821 CAGTGTGCTCAGAGAACAGCTGG - Intronic
925576299 2:5363792-5363814 CAAAGTGCTGAGATTACAGTCGG + Intergenic
927307437 2:21589680-21589702 CAATGTTGTCAAAGTATAGTGGG + Intergenic
928771440 2:34706622-34706644 CAATGTCCTCAGTGTATGGTGGG - Intergenic
929918856 2:46158059-46158081 CAATTTGCTGAGTGTACAGTGGG + Intronic
930357577 2:50341423-50341445 AAAAGTGCCCAGACTATAGTAGG - Intronic
932152405 2:69385484-69385506 CAAAGTGCTGAGATTATAGGCGG + Intronic
932723495 2:74157730-74157752 CTGTGTGGTGAGAGTATAGTAGG + Intronic
933446290 2:82383815-82383837 CAATGATCTCAGAGAATATTAGG - Intergenic
933840597 2:86283100-86283122 CACTGTGCTATGAGTGTAGTGGG - Intronic
934059586 2:88281777-88281799 CAATGTGCTCTGAAGATAGCAGG + Intergenic
937816596 2:126257750-126257772 CAATATTTTCAGAGTATATTGGG - Intergenic
939228416 2:139393805-139393827 CAGTGTGATCAGAGGATATTTGG - Intergenic
939487063 2:142827491-142827513 CAGGGTGTTCATAGTATAGTGGG + Intergenic
939647340 2:144716946-144716968 CTAGGTGCTCAGAGAATATTTGG + Intergenic
942614461 2:177775892-177775914 CAAAGTGCTTACAGTCTAGTAGG - Intronic
944958290 2:204838005-204838027 CAAGGAGCTCACAGTATAATGGG + Intronic
946941483 2:224774318-224774340 CAAGGTGCTCACAGTCTGGTAGG - Intronic
1171265397 20:23767678-23767700 CCAGGAGCTCAGAGTATAGATGG + Intergenic
1171275074 20:23849764-23849786 CCAGGAGCTCAGAGTATAGCTGG + Intergenic
1171490340 20:25512313-25512335 CAATGTGCTAAGAGTAGAAAAGG - Intronic
1171796377 20:29569676-29569698 CATGGTGCTCACAGTCTAGTGGG + Intergenic
1171851860 20:30314492-30314514 CATGGTGCTCACAGTCTAGTGGG - Intergenic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1175597057 20:60243687-60243709 CAATGAGGTCAGAGTAGAGTGGG - Intergenic
1175627171 20:60499196-60499218 AAATATGCCCAGAGCATAGTAGG + Intergenic
1181812199 22:25410265-25410287 CAAAGTGCTAAGATTATAGGTGG + Intergenic
1182259125 22:29060292-29060314 CAAAGTGCTGAGATTATAGGCGG + Intronic
1182742851 22:32581368-32581390 CAAAGTGCTGGGATTATAGTAGG + Intronic
949479381 3:4478956-4478978 CAAAGTGCTGAGATTATAGGCGG - Intergenic
950086491 3:10261983-10262005 AAATGTGATCAGAGTATACAAGG - Intronic
950655452 3:14433538-14433560 CAAAGTGCTGAGATTATAGATGG - Intronic
951548310 3:23851540-23851562 CAAAGTGCTGGGAATATAGTAGG - Intronic
956150516 3:66237097-66237119 CAAAGTGCTGGGATTATAGTCGG + Intronic
959903276 3:111683666-111683688 CAAAGAGCTGACAGTATAGTTGG + Intronic
960671549 3:120159415-120159437 CAAAGAGCTCACAGTCTAGTGGG + Intergenic
960742337 3:120848635-120848657 CATTGAGCTCACAGTCTAGTGGG + Intergenic
961031244 3:123605854-123605876 CAAAGTGCTGAGATTACAGTTGG + Intergenic
962006355 3:131353794-131353816 CAGTGGGCTCAGAGTAAAGGAGG + Intergenic
962839062 3:139217380-139217402 GAATGTGCTCAGAATATAGGGGG + Intronic
963338743 3:144007964-144007986 GTATGTGCTCAGAATATAGAGGG + Intronic
964667330 3:159188798-159188820 CAATGTGCCCAGCTCATAGTAGG + Intronic
966344667 3:178965232-178965254 TTCTGTGCTGAGAGTATAGTAGG + Intergenic
966552055 3:181216216-181216238 CAAAGAGCTAAGAGTCTAGTTGG + Intergenic
967290116 3:187911354-187911376 CCATATGCTCAGAGTCCAGTGGG - Intergenic
968369834 3:198216989-198217011 CAAAGTGCTAAGATTATAGCTGG - Intergenic
968681058 4:1920186-1920208 CAATGTGCTGAGATTACAGGCGG - Intronic
969856372 4:10002950-10002972 CAAGGAGCACAGAGTCTAGTGGG + Intronic
973246146 4:48013376-48013398 CAAGGTGGTCAGAGCACAGTTGG + Intronic
974403559 4:61436441-61436463 CAAGGAGCTCATAGTCTAGTAGG + Intronic
974831411 4:67193856-67193878 CACTGTGCTCAGCATATAGTAGG + Intergenic
976044058 4:80923568-80923590 TAATGTGCTCATAATATAATAGG - Intronic
976705253 4:88013332-88013354 CAAGGAGCTCAGGGTTTAGTAGG + Intronic
977761238 4:100739316-100739338 CAAGGAGCTAAGAGTTTAGTGGG - Intronic
978904722 4:113992353-113992375 CAATGTTCTCAGTAAATAGTTGG - Intergenic
980551725 4:134345083-134345105 CAATGTGCTGAGTATCTAGTAGG + Intergenic
980807260 4:137829974-137829996 CTATGTGCTCTAAGTATATTAGG - Intergenic
984290378 4:177787017-177787039 CAAAGTGCTGAGATTATAGGTGG + Intronic
985880456 5:2635335-2635357 CAATGGGCTCAGTGCACAGTTGG - Intergenic
986245282 5:6001393-6001415 CAAGGAGCTCACAGTCTAGTGGG - Intergenic
986870609 5:12041071-12041093 CTATGGCCTCATAGTATAGTTGG - Intergenic
987816941 5:22914598-22914620 CAATGTGCTGAAAGTCTATTGGG - Intergenic
989512867 5:42308908-42308930 CCATGTGGTGAGAGTATAATAGG - Intergenic
992220852 5:74571666-74571688 CTATGTTCTGAGAGTATGGTTGG + Intergenic
992229888 5:74653879-74653901 CAAAGAGCTCAGAGACTAGTAGG + Intronic
992916344 5:81457177-81457199 CAATGTGCTCAGAGAAAAATGGG + Intronic
993118926 5:83751367-83751389 CACTGTGCCCGGACTATAGTAGG + Intergenic
993831168 5:92760016-92760038 CAGTGTCCTCAGAGTATAACTGG - Intergenic
993928184 5:93898968-93898990 AAATGGGATCAGAGTCTAGTTGG + Intronic
996836754 5:127802165-127802187 CAATGTCCCTAGAGTCTAGTGGG - Intergenic
997139636 5:131364876-131364898 CAGTGTGCTCAGTGTTTAGATGG + Intronic
997660020 5:135582309-135582331 CAAGCAGCTCAGAGTCTAGTGGG + Intergenic
997877453 5:137561942-137561964 CAATGAGCTCACAGCATAGAGGG + Intronic
998299974 5:141008723-141008745 CAGTGTGCTCACAGTCTAGTTGG - Intronic
998882318 5:146656344-146656366 GAGTGTGCTCAGAGTACAGGAGG + Intronic
1000233967 5:159340535-159340557 TAATGTGCTCACAGTATTCTAGG + Intergenic
1000345017 5:160307277-160307299 CAAGGAGCTCACAGTCTAGTGGG + Intronic
1000693111 5:164346934-164346956 CAAGGAGCTCACAGTCTAGTGGG + Intergenic
1002729113 5:181322567-181322589 CAAAGTGCTAAGATTATAGCTGG - Intergenic
1003013148 6:2445296-2445318 GAACGTGCTCAGCATATAGTGGG + Intergenic
1003685431 6:8297709-8297731 CAAGGAGCTCAGAGTTTAGGTGG - Intergenic
1003879170 6:10464798-10464820 CAATGGGGTCAAAGTATTGTTGG - Intergenic
1004311679 6:14551641-14551663 CAAAGTGCTGAGATTATAGGGGG - Intergenic
1004603204 6:17170477-17170499 GAATGAGGTCAGACTATAGTTGG + Intergenic
1007604401 6:43106555-43106577 CAAAGTGCTGAGATTATAGCAGG + Intronic
1007663730 6:43502380-43502402 CACTGTGCTCATAGCATAGCAGG + Intronic
1008031967 6:46706935-46706957 CTATGGGCTCAGAGAATAGAGGG - Intronic
1008041603 6:46807410-46807432 CAAAGTGCTGAGATTATAGGTGG - Intronic
1009037401 6:58134301-58134323 CAATGTGCTGAGATTACAGGTGG - Intergenic
1009213195 6:60887921-60887943 CAATGTGCTGAGATTACAGGTGG - Intergenic
1010055487 6:71559177-71559199 AAATGTGCTCATAGTCTAATGGG + Intergenic
1010498946 6:76570598-76570620 AAATCTGCTCAGAGTAGATTTGG + Intergenic
1010712757 6:79194417-79194439 TATGGTGCTTAGAGTATAGTGGG - Intergenic
1012868945 6:104651002-104651024 TAATTTCCTCTGAGTATAGTGGG + Intergenic
1014977761 6:127910265-127910287 CAATGCTCTCAGAGTTTAATTGG - Intronic
1016776056 6:147905920-147905942 CAAATTGCTCAGCGTCTAGTGGG - Intergenic
1016925649 6:149344541-149344563 CAGTGTGCATAGAGAATAGTTGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018593288 6:165451816-165451838 CAATGAGCTCACATTCTAGTTGG + Intronic
1019365706 7:631618-631640 CAGTGTGCTCGGAGGACAGTGGG - Intronic
1021672787 7:23048831-23048853 CAAGTTGCTCAGAGAATAGAGGG - Intergenic
1022193191 7:28037065-28037087 CAATCTGTTCAGAGTTTATTTGG + Intronic
1022714611 7:32888124-32888146 CAATGTTTTCAGAGAATATTGGG + Intronic
1023400521 7:39790264-39790286 CAAAGTGCTAAGATTATAGCTGG - Intergenic
1024073453 7:45806009-45806031 CAAAGTGCTAAGATTATAGCTGG - Intergenic
1024649881 7:51394194-51394216 CAAAGTGCTAAGATTATAGCTGG + Intergenic
1025053966 7:55749525-55749547 CAAAGTGCTAAGATTATAGCTGG + Intergenic
1025132073 7:56379998-56380020 CAAAGTGCTAAGATTATAGCTGG + Intergenic
1026283020 7:68938476-68938498 CAATGTACTTAGTGTTTAGTAGG - Intergenic
1028801554 7:94971065-94971087 AGATGAGCTCAGAGTCTAGTAGG + Intronic
1029201577 7:98842858-98842880 CAAAGTGCTGAGATTATAGGTGG - Intergenic
1029809728 7:103035101-103035123 CAGTGTGGTCTGAGTAAAGTTGG + Intronic
1032050844 7:128649704-128649726 CAAAGTGCTAAGATTATAGCTGG - Intergenic
1032747536 7:134802652-134802674 AAATGTGCTCAGAGCACAGTTGG + Intronic
1033107820 7:138545759-138545781 CAAAATGCTCAGAGAATAATGGG + Intronic
1034278000 7:149832473-149832495 CAAGGGGCTTAGAGTCTAGTTGG - Intergenic
1035955191 8:4069711-4069733 CAAGGTGCCTAGAGTTTAGTGGG - Intronic
1036778248 8:11628361-11628383 CAAGGTGCTTACAGTCTAGTTGG + Intergenic
1038635738 8:29285729-29285751 CAAAGTGCTAAGATTATAGGTGG + Intergenic
1040881172 8:52206225-52206247 CAATGTGCACAGCGTCTGGTTGG - Intronic
1041735426 8:61106073-61106095 GAATCTGCTCACAGTCTAGTAGG - Intronic
1043933687 8:86119115-86119137 CAATGTGCCCAGAATACACTGGG + Intronic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1044952061 8:97444614-97444636 CAATGTGCTCAGGGTGTTTTGGG - Intergenic
1045695483 8:104804826-104804848 GAATGTGCTCAGCATATATTGGG + Intronic
1045912844 8:107430410-107430432 CAAGGAGCTCAAAGTATAGTTGG - Intronic
1045980186 8:108176374-108176396 CACAGTGCTTAGAATATAGTGGG + Intergenic
1046694285 8:117321272-117321294 TATTGTGCTCAGAGTGTACTGGG - Intergenic
1046806190 8:118481366-118481388 CAGTGTTCTCAGCGTGTAGTAGG + Intronic
1046832392 8:118760892-118760914 AATTTTGCTCAGAGTCTAGTAGG + Intergenic
1046893868 8:119451738-119451760 CAAAGTGCTCAGAATATTATGGG - Intergenic
1047146724 8:122209102-122209124 CAAAGTGCTGAGATTACAGTTGG - Intergenic
1047194676 8:122710947-122710969 TAATTTGGTCAGGGTATAGTAGG + Intergenic
1047724538 8:127672375-127672397 CAACGTGCTTAGAGTGTGGTGGG - Intergenic
1047744041 8:127830620-127830642 CAACGTGCTAGGACTATAGTAGG - Intergenic
1047864582 8:129008422-129008444 CAAAGTGCTAAGATTATAGGTGG - Intergenic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1052772798 9:32704917-32704939 CACCTTGCTCAGAGTCTAGTGGG - Intergenic
1053789645 9:41677746-41677768 CATGGTGCTCACAGTCTAGTGGG - Intergenic
1054155499 9:61637007-61637029 CATGGTGCTCACAGTCTAGTGGG + Intergenic
1054177983 9:61889437-61889459 CATGGTGCTCACAGTCTAGTGGG - Intergenic
1054475284 9:65568117-65568139 CATGGTGCTCACAGTCTAGTGGG + Intergenic
1054659546 9:67691387-67691409 CATGGTGCTCACAGTCTAGTGGG + Intergenic
1056178463 9:84058699-84058721 CAATATACTCACAGTATAATTGG + Intergenic
1057157333 9:92854454-92854476 CAAAGTGCTGAGATTATAGGCGG - Intronic
1057517214 9:95731952-95731974 CAATGTGCCCAGATAAAAGTTGG + Intergenic
1057592170 9:96382089-96382111 CAATGGGCTCAGTATTTAGTAGG + Intronic
1057835678 9:98443103-98443125 CATAGTGCTCAGCATATAGTAGG + Intronic
1058260569 9:102824969-102824991 CCATGTGCTGAGAGTACAGAGGG + Intergenic
1058464448 9:105213901-105213923 CAATGTGCTCTGAGTAGAAGGGG - Intergenic
1058482207 9:105407606-105407628 CAAAGTGCTGAGATTACAGTGGG - Intronic
1059204738 9:112453702-112453724 CAAAGTACTCAGATTATAGAAGG + Intronic
1060446711 9:123695636-123695658 CAAGGAGCTCAGTGTCTAGTGGG + Intronic
1060747775 9:126149075-126149097 CCATGTGCTCAGAGAAGACTGGG + Intergenic
1203576693 Un_KI270745v1:14447-14469 CAAAGTGCTAAGATTATAGCTGG - Intergenic
1203577090 Un_KI270745v1:17869-17891 CAAAGTGCTAAGATTATAGCTGG - Intergenic
1186284704 X:8031106-8031128 CACTGTGCACAGACTAAAGTGGG + Intergenic
1186284707 X:8031140-8031162 CACTGTGCACAGACTAAAGTGGG + Intergenic
1186773459 X:12840089-12840111 CAAAGTGCTGGGATTATAGTCGG - Intergenic
1188309135 X:28596090-28596112 CATTGTGCACAGCATATAGTAGG + Intronic
1188407813 X:29833519-29833541 AAATGTGCTCAGAGTAGCATGGG - Intronic
1188591041 X:31835456-31835478 CAATGTGCTCAGTATTTAGTTGG - Intronic
1188665304 X:32812369-32812391 CAAAGTGCTGGGAGTATAGGCGG - Intronic
1188730945 X:33646300-33646322 CAAAGTGCTAAGATTACAGTGGG - Intergenic
1189340053 X:40198070-40198092 CAAAGTGCTGGGATTATAGTTGG + Intergenic
1189779555 X:44501054-44501076 CCATGTGCTCATAGTAAAATGGG - Intergenic
1190534511 X:51412270-51412292 CAAAGTTCTCATAGTCTAGTGGG - Intergenic
1192830786 X:74749057-74749079 CAAGATGCTCAGAGTCTAGAGGG + Intronic
1193104029 X:77648905-77648927 CAAAGTGCTGTGACTATAGTAGG - Intronic
1193525937 X:82589276-82589298 AAAAGTGTTCAGAGTACAGTAGG + Intergenic
1194007351 X:88511967-88511989 CAATGGGCTGAGAGTATAAATGG + Intergenic
1194771660 X:97914443-97914465 CATTGTGCTCAGAATACAATTGG - Intergenic
1195086753 X:101420460-101420482 CAAGGAGCTCATAGTACAGTGGG + Intronic
1195220858 X:102744886-102744908 CAATGTGCTGAGAATACAGTGGG + Intronic
1195421951 X:104685506-104685528 CAATGTGCTCAGGGTTTCATAGG - Intronic
1196906801 X:120444885-120444907 CAATGTCCCCAGAGTTCAGTGGG - Intronic
1196972981 X:121129987-121130009 CATGGAGCTCACAGTATAGTGGG - Intergenic
1197276431 X:124484867-124484889 CAAAGAGCTCACAGTGTAGTTGG - Intronic
1198157945 X:133981279-133981301 CAAGGAGCTCACAGTCTAGTGGG - Intronic
1198565137 X:137896519-137896541 CAAGGAGCTCACAGTCTAGTGGG + Intergenic
1198697971 X:139364131-139364153 TAAAGTGGTCAGAGGATAGTAGG + Intergenic
1198998234 X:142601567-142601589 CCAAGTGCTCACAGTCTAGTAGG + Intergenic
1199113942 X:143967872-143967894 CAAGGAGCTCAGAGTCAAGTGGG - Intergenic
1199322612 X:146458240-146458262 CATTGTTCTGAGAGTATGGTTGG - Intergenic
1199743922 X:150760051-150760073 CACTGTGCTCGGAGGGTAGTAGG + Intronic
1199838403 X:151617563-151617585 CAATGAGCACATAGTCTAGTAGG - Intronic
1202165912 Y:21987621-21987643 TAATGTTCTCTGAGTAAAGTCGG + Intergenic
1202225446 Y:22598751-22598773 TAATGTTCTCTGAGTAAAGTCGG - Intergenic
1202317667 Y:23596910-23596932 TAATGTTCTCTGAGTAAAGTCGG + Intergenic
1202553099 Y:26073148-26073170 TAATGTTCTCTGAGTAAAGTCGG - Intergenic