ID: 1116447157

View in Genome Browser
Species Human (GRCh38)
Location 14:45023218-45023240
Sequence CTCAAACCTATGCCGCTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 2, 1: 20, 2: 32, 3: 27, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116447157_1116447159 23 Left 1116447157 14:45023218-45023240 CCCTCGAGCGGCATAGGTTTGAG 0: 2
1: 20
2: 32
3: 27
4: 63
Right 1116447159 14:45023264-45023286 TCTATATTTTCTTCATTGTCTGG 0: 1
1: 56
2: 28
3: 63
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116447157 Original CRISPR CTCAAACCTATGCCGCTCGA GGG (reversed) Intronic
900954858 1:5880573-5880595 CTCTAACCTCGGCCTCTCGATGG + Intronic
904953575 1:34264118-34264140 TTCAAACCTGTGCCGTTCAAGGG - Intergenic
905950685 1:41948070-41948092 CTCAAACCTATGCTGATTGAGGG + Intronic
906583712 1:46957446-46957468 CTCAAACCTACACCACTCAAGGG + Intergenic
910052712 1:82994508-82994530 TTCAAACCTATGTTGCTCAAGGG + Intergenic
910591335 1:88930438-88930460 CTCAAACCTGCGCCGCTCGAGGG + Intergenic
910804787 1:91179683-91179705 CTCAAACCTGCACCACTCGAGGG + Intergenic
912463631 1:109854084-109854106 CTCAAACATACGCCACTCAAGGG - Intergenic
913468712 1:119169733-119169755 CTCAAACCTATGCCACTCGAGGG - Intergenic
922684390 1:227627894-227627916 TTCAAACCTACACCGCTCGAGGG - Intronic
923161263 1:231316833-231316855 CTCAAACCTATGTTGCTCACTGG - Intergenic
923195712 1:231664768-231664790 TTCAAACCTGTGTCGTTCGAGGG - Intronic
1063993232 10:11589863-11589885 ATCAAACCGGTGCCGCTCCAGGG + Intronic
1065199213 10:23297664-23297686 CTCAAACCTATGCCGCTCAGGGG - Intronic
1067713213 10:48666733-48666755 CTCAAACCTATGCCACTTGAGGG - Intergenic
1068791525 10:61035605-61035627 CTCAAACCTACACCACTCGAGGG - Intergenic
1069327553 10:67250103-67250125 CTCAAACCCATGCTGTTCAAGGG - Intronic
1071213367 10:83370068-83370090 CTCAAACCTATTCAGCTACATGG - Intergenic
1072377809 10:94835995-94836017 CTCAAACCTACACCACTCGAGGG - Intronic
1072471620 10:95718848-95718870 CTCAAACCTATGCCACTCGAGGG - Intronic
1074949097 10:118311548-118311570 CTCAAACTGAGGCCCCTCGAGGG + Intronic
1075813367 10:125245144-125245166 CACAGACCTATGACGCTCCATGG - Intergenic
1085601477 11:77859729-77859751 CTCAAACCTATGCCACTTGAGGG - Intronic
1086441691 11:86835008-86835030 CTCAAACCTATGCCACTTGAGGG - Intronic
1088265286 11:107982564-107982586 CTCAAACCTATGCCACTCGAGGG - Intergenic
1092469157 12:8762886-8762908 CTCACACCTACGCCGCTTAAGGG - Intronic
1096351782 12:50906665-50906687 CTCAAACCTGTGCTGCTCGAGGG - Intergenic
1097376960 12:58853737-58853759 CTCAAACCTACGCCACTCGAGGG - Intergenic
1103803408 12:123554438-123554460 CTCAAACCTATGCCACTCAAGGG + Intergenic
1104851199 12:131875075-131875097 CTCAAACTTGTGCCGCTCGAGGG - Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108422593 13:50266209-50266231 CTGAAACCTTTGCAGCTTGAGGG + Intronic
1108876969 13:55059611-55059633 CTCAAACCAACTCCACTCGAGGG + Intergenic
1112160430 13:96861279-96861301 TTCAAACCCATGTTGCTCGAGGG - Intergenic
1114384605 14:22242260-22242282 CTCAAACCTATGCCGCTCGAGGG + Intergenic
1116447157 14:45023218-45023240 CTCAAACCTATGCCGCTCGAGGG - Intronic
1117672729 14:58124683-58124705 CTCAAACCTACGCTGCTCGAGGG + Intronic
1123934984 15:25189769-25189791 CACTCACCTATGCCGCTCAAGGG - Intergenic
1127073992 15:55308599-55308621 CTCAAACCTACACCGCTCGAGGG - Intronic
1128362274 15:66970645-66970667 CTCAAACCTACACCACTCGAGGG - Intergenic
1131420478 15:92300740-92300762 CTCAAACCTACGCCACTCGAGGG + Intergenic
1132192603 15:99880768-99880790 TTCAAACCCATGCTGTTCGAGGG + Intergenic
1135156266 16:20055508-20055530 CTCAAACCTAGTCCACCCGATGG + Intronic
1148934441 17:51153640-51153662 TTCAAACCTAAGCAGCTGGAAGG + Exonic
1149273793 17:55012853-55012875 CTCAAACCTATGCCACTCGAGGG - Intronic
1151636601 17:75353383-75353405 CTCAAACCTCTGTTGCTCAAGGG + Intronic
1153401843 18:4690591-4690613 CTCAAACCTGTGCTGCTCAAGGG + Intergenic
1157217067 18:45793131-45793153 CTCAAGGCTGTGCCGCTGGAAGG - Intergenic
1158731172 18:60024038-60024060 TTCAAACCTATGCTGTTCAAGGG - Intergenic
1158785971 18:60712262-60712284 CTCAAACCTATGCCGCTCAAGGG + Intergenic
1163134084 19:15296715-15296737 CTTAAAGCTCTGCCGCTGGACGG - Intronic
1164173851 19:22750620-22750642 CTCAAACCTATGTCACTCAAAGG + Intergenic
924973838 2:155401-155423 CTCAAGCCTATGCCACTCGAGGG - Intergenic
926018232 2:9473479-9473501 CTCAAGCCTCTGCTGCTTGAAGG + Intergenic
926864766 2:17344803-17344825 CTCAAACCTATGCCACTCGAGGG + Intergenic
932917975 2:75877601-75877623 CTCAAACCTGTGCAGCTAGAGGG + Intergenic
933174960 2:79164597-79164619 CTCAAACCTACCCCGCTCGAGGG - Intergenic
935748983 2:106213888-106213910 CTCAAACCTACACCACTCAAGGG + Intergenic
937556020 2:123157050-123157072 CTCCAACCTATACCTCTCCACGG + Intergenic
938944900 2:136203220-136203242 CTAAAACCTATGCCACTCAAGGG - Intergenic
939493362 2:142901897-142901919 TTCAAACCTATACCACTCGAGGG - Intronic
941370660 2:164659359-164659381 CTCAAACCTATGCCACTCGAGGG - Intronic
941991487 2:171561452-171561474 CTCAAACCTTCACCACTCGAGGG - Intergenic
946129170 2:217592284-217592306 CTCAAACGTATGCCACTTGAGGG - Intronic
947286077 2:228516304-228516326 CACAAACCTCTGCAGCTCCAAGG - Intergenic
948580228 2:238982104-238982126 CTCAAACCTACGCTGCTCGAGGG - Intergenic
1168738469 20:166572-166594 CACAAACCTATACCGGTCCATGG - Intergenic
1168741100 20:192138-192160 TTCAAACCTACGCTGCTCAAGGG - Intergenic
1174977411 20:55350767-55350789 CTCAAACCTACGCCACTCGAGGG + Intergenic
1177263217 21:18754626-18754648 CTCAAACCTATGCCACTAGAGGG - Intergenic
1177635675 21:23783939-23783961 CCCAAACCCATGTTGCTCGAGGG - Intergenic
1177896558 21:26860599-26860621 CTCAAACCTACACTGCTCGAGGG + Intergenic
1179258838 21:39740689-39740711 CTCAAACCTATGCCACTCGAGGG - Intergenic
1203312753 22_KI270736v1_random:154238-154260 CTCCATTCTATGCCGCTCCATGG - Intergenic
952921921 3:38291292-38291314 CTCAAACCTACGCCGCTCAAGGG - Intronic
953085153 3:39658614-39658636 CTCAAACCTATGCCGCTCAAGGG + Intergenic
956999982 3:74874270-74874292 CTCAAACCTATGCTGCTCGAGGG - Intergenic
959830853 3:110860622-110860644 CTGAAACCTATGTTGTTCGAGGG + Intergenic
961991675 3:131198309-131198331 CTCAAACCTATGCCACTTGAAGG - Intronic
962495751 3:135937447-135937469 CTCACACCTATGCCACTTGAGGG + Intergenic
963188262 3:142441825-142441847 CTCAAACCTAAGCCGCTCGAGGG + Intronic
963809182 3:149757905-149757927 CTCAAACCTATGCCGCTCAAGGG - Intergenic
963916065 3:150859882-150859904 CTCAAACCTACACCACTCGAGGG + Intergenic
964953728 3:162326904-162326926 CTCAAACCTATGCCACTTGAAGG + Intergenic
965054500 3:163696358-163696380 CTCAAACCTACACTGCTCGAGGG - Intergenic
966353805 3:179058372-179058394 CTCAAACCTATGCCACTCGAGGG + Intronic
967623847 3:191664130-191664152 CTCAAACCTGTGCCACTAGAGGG + Intergenic
967880407 3:194297391-194297413 CTCAAACTCAGGCCGCTAGAGGG - Intergenic
967963312 3:194942040-194942062 CTCAACCCAATGGCACTCGAAGG - Intergenic
969645265 4:8424769-8424791 CTCAAACCTACGCCGCTCGAGGG + Intronic
970914332 4:21315168-21315190 CTCTAACCTATGTCGTTCAAGGG - Intronic
972179204 4:36443129-36443151 CTCAAACCTATGCCACTCAAGGG - Intergenic
972781053 4:42287249-42287271 CTCAAACCTACGGCGCTCGAGGG - Intergenic
974337986 4:60576368-60576390 TTCAAACCCATGTCGTTCGAGGG - Intergenic
975068376 4:70098925-70098947 TTCAAACCTATGCTGTTCAAGGG + Intergenic
976464652 4:85353565-85353587 CTCAAACCTACTCCACTCAAGGG - Intergenic
978155744 4:105488021-105488043 CTCAAACCTATGCTGCTCGAAGG + Intergenic
978586495 4:110280643-110280665 CTCAAACCTAGGCCGCTCGAGGG - Intergenic
980254694 4:130363523-130363545 TTCAAACCCATGTCGCTCAAGGG - Intergenic
980872500 4:138625933-138625955 CTCAAAGCTACGCTGCTCGAGGG - Intergenic
982846828 4:160263658-160263680 TTCAAACCTGTGCTGCTCAAGGG + Intergenic
983344853 4:166515150-166515172 TTCAAACCTATGTTGCTCAAGGG + Intergenic
984724040 4:183002944-183002966 CTCAAACCTATGCTGCTCTAGGG + Intergenic
990892585 5:60664569-60664591 CTCAAACCTACGCTGCTCGAGGG + Intronic
994527077 5:100919190-100919212 CTCATTCTTATGCCGCTCTAAGG - Intergenic
995465943 5:112449598-112449620 CTCAAACCTATTCCGCTTGAGGG + Intergenic
1002890925 6:1331024-1331046 CTCAAACCTACGCCACTTGAGGG - Intergenic
1007653549 6:43438296-43438318 CTCAAACCTATGCTCCTCTCTGG - Intronic
1009545091 6:65010506-65010528 CTCAAACATACGCCACTTGAGGG + Intronic
1009958565 6:70488839-70488861 ATCAAACCTATGTTGCTCAAGGG + Intronic
1010893759 6:81342723-81342745 CTCAAACCTATGCCACTTGAAGG + Intergenic
1011077082 6:83448943-83448965 CTCAAACCTACACCGCTCAAAGG + Intergenic
1011189480 6:84714691-84714713 TGCAAACCTATGCTGCTCAAGGG - Intronic
1011539554 6:88415622-88415644 CTCAAACCTATGCCACTCAAGGG - Intergenic
1013330021 6:109091126-109091148 TTCAAACCTATGCTGTTCAAGGG + Intronic
1013543856 6:111136638-111136660 CTCAAACCTACGCCGCTTGAGGG + Intronic
1016342945 6:143082363-143082385 CTCAAACCTATGCCGCTCAAGGG - Intronic
1016444408 6:144117764-144117786 CTCAAACCTATGCCACTCGAGGG - Intergenic
1018761349 6:166896795-166896817 CTCAAACCTGTGCTGCTCGAGGG + Intronic
1028588275 7:92472097-92472119 CTCAAACCTATGCCACTCGAGGG - Intronic
1029913891 7:104186162-104186184 TTCAAACCTATGTCGTTCAAGGG - Intronic
1030337605 7:108343016-108343038 TTCAAACCTACGCCACTCAAGGG + Intronic
1030843200 7:114380528-114380550 CTCAAAACTACGCCACTTGAAGG - Intronic
1034277962 7:149832020-149832042 CTCAACCCTCGGCCGCTCTACGG + Intergenic
1035924227 8:3710255-3710277 TTTAAACCTATGCTGCTCAAGGG + Intronic
1036408472 8:8477041-8477063 CTGAAACCTATGGAGCTCGTTGG + Intergenic
1040527449 8:48237378-48237400 CTCAAACCTACGCCACTTGAAGG - Intergenic
1041663566 8:60421734-60421756 CTCAAACCTACGCTACTCGAGGG - Intergenic
1041867815 8:62596790-62596812 CTCAAACCTATGCTGTTCGAGGG - Intronic
1042364577 8:67922175-67922197 CTCAAACCTACGTCACTCGAGGG + Intergenic
1043490273 8:80741726-80741748 CTCAAACCTACGCCGCTCGAGGG + Intronic
1047443723 8:124901309-124901331 CTCAAACCTACGCCACTTGAGGG - Intergenic
1049049984 8:140187111-140187133 GTCAAACCTATGTAGTTCGAGGG - Intronic
1053134561 9:35642183-35642205 CTCAAACCAGTGCCGCTAGAGGG - Intronic
1055477667 9:76678878-76678900 CTCAGACCTGTGCTTCTCGAAGG - Intronic
1057178382 9:93015848-93015870 CTCAAACCTGTCCCCCTGGAAGG + Intronic
1058844237 9:108940072-108940094 TTCAAACCTATGTTGCTCAAGGG - Exonic
1062189714 9:135241819-135241841 CTCAAACCTGTGCAGCTTCATGG - Intergenic
1191166742 X:57400024-57400046 CTCAAACCTACACCACTCGAGGG - Intronic
1191924902 X:66298515-66298537 CTCAAACCTACGCTGCTCGAGGG - Intergenic
1192939667 X:75899719-75899741 CTCAAACCTACGCCACTCGAGGG - Intergenic
1195535257 X:106002668-106002690 CTCAAACCTACACCGCTCTAGGG + Intergenic
1196527043 X:116739398-116739420 CTTAAACATACGCCGCTTGAGGG - Intergenic
1201905917 Y:19085618-19085640 CTCAAACCTACGCTGCTCAAGGG + Intergenic