ID: 1116452831

View in Genome Browser
Species Human (GRCh38)
Location 14:45083971-45083993
Sequence CGCCCTCGCTCGCGGCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116452820_1116452831 14 Left 1116452820 14:45083934-45083956 CCCTATGGAGGGAAAGGCAGGTA 0: 1
1: 0
2: 1
3: 11
4: 206
Right 1116452831 14:45083971-45083993 CGCCCTCGCTCGCGGCGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 105
1116452815_1116452831 26 Left 1116452815 14:45083922-45083944 CCTTTGGGAAGTCCCTATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1116452831 14:45083971-45083993 CGCCCTCGCTCGCGGCGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 105
1116452821_1116452831 13 Left 1116452821 14:45083935-45083957 CCTATGGAGGGAAAGGCAGGTAG 0: 1
1: 0
2: 1
3: 23
4: 243
Right 1116452831 14:45083971-45083993 CGCCCTCGCTCGCGGCGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116452831 Original CRISPR CGCCCTCGCTCGCGGCGGGG CGG Intergenic
900577959 1:3393744-3393766 CGCCCTTGCCAGCGGCGCGGAGG - Intronic
901491148 1:9597032-9597054 CGCCTTCGCTCCCCGCGAGGAGG + Exonic
902350029 1:15847648-15847670 CGCGCGCGCCCGCGGCGAGGGGG + Intergenic
903142149 1:21345269-21345291 CGCCCTGGCTCGCGGGGGGCTGG - Intronic
903614676 1:24643262-24643284 CGCCCTCCGTCGCGGCGGCGCGG + Exonic
905521999 1:38607702-38607724 CGCCCTCTCTCGGGGTGGGCTGG + Intergenic
906193322 1:43913101-43913123 CCCCCTGGCTCCCGGTGGGGAGG - Intronic
907444739 1:54500224-54500246 CGCCCTGGCTCGGGGAGCGGGGG + Intergenic
908293151 1:62688090-62688112 CGGCCTGGCTCGCGGCGGGGCGG - Intronic
910771506 1:90836217-90836239 CGCCCCAGCCCCCGGCGGGGCGG + Intergenic
917135009 1:171781367-171781389 GGCCCTCCCTCCAGGCGGGGCGG - Intergenic
920394098 1:205631562-205631584 CGCCCCCGCTCCCGGCCGGTGGG + Intronic
923744285 1:236686370-236686392 CGCACGTGCTCGGGGCGGGGCGG + Intergenic
1065025181 10:21534368-21534390 CGCCCGCGTTAGCGGCCGGGTGG + Exonic
1067081724 10:43216175-43216197 CGCCCCCGCTCCTGGCAGGGTGG - Intronic
1068620482 10:59176586-59176608 GGCGCGCGCTCCCGGCGGGGAGG - Exonic
1069582143 10:69573376-69573398 CGCTCTCTCTCGAGGCGCGGCGG + Intergenic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1071309368 10:84328531-84328553 CGCACGGGCCCGCGGCGGGGCGG + Intergenic
1071544853 10:86521557-86521579 CGGCGGCGCTCGAGGCGGGGAGG - Exonic
1071629041 10:87203608-87203630 CGGCTCCCCTCGCGGCGGGGAGG + Intergenic
1071695286 10:87863506-87863528 CGCCCGGGCTCCCGGCGCGGCGG + Exonic
1075031945 10:119029755-119029777 GGCCCGCGCCGGCGGCGGGGAGG + Exonic
1075072966 10:119331126-119331148 GGCCCATGGTCGCGGCGGGGGGG - Intronic
1076217950 10:128710981-128711003 AGCCCTCCCTCGAGGCCGGGTGG - Intergenic
1076737612 10:132465793-132465815 CCCCCTCGCTCAGGGCGTGGTGG - Intergenic
1083458075 11:62792076-62792098 CCCCCTCGCTCAGGGCTGGGAGG + Intergenic
1083901840 11:65647088-65647110 GGCCCCTGCGCGCGGCGGGGCGG + Intronic
1084087455 11:66861134-66861156 CGCCCTCCCTCGCTGCAGGGAGG + Intronic
1084611037 11:70203201-70203223 CGCCCTGGCTGGCGGCGCCGCGG - Exonic
1085123709 11:73983280-73983302 CGCGCTCGCTCGCAGGAGGGTGG - Exonic
1085266751 11:75241916-75241938 CGCCGACGCTCGCGGAGAGGAGG + Exonic
1085561090 11:77473607-77473629 CGCCCTCACTCCCGGCTAGGCGG - Exonic
1091718227 12:2794915-2794937 GCCCCTCCCTCGCGGCGGGGCGG + Intergenic
1093435274 12:19129559-19129581 CCCCCGAGCGCGCGGCGGGGCGG + Intergenic
1098425944 12:70366174-70366196 CGCCCCCGGGCGGGGCGGGGCGG + Intergenic
1101409850 12:104458513-104458535 CGCCCTCGAGCGCGGCGGCCGGG + Intronic
1106190727 13:27450379-27450401 CGCCCTCGGTACCGGCGGGACGG + Intronic
1107479189 13:40771282-40771304 CGGACTCGCCCGCGGCCGGGCGG + Intergenic
1108542064 13:51453629-51453651 CGCGCCCGCTCGCGCCGGGGCGG - Intronic
1108590088 13:51905565-51905587 AGCCCTCCCTCGCAGCGGCGCGG + Intergenic
1114482196 14:23042831-23042853 CGCCCTGGCTCGCTGCGCCGTGG + Exonic
1116452831 14:45083971-45083993 CGCCCTCGCTCGCGGCGGGGCGG + Intergenic
1118801256 14:69191787-69191809 CCCCGTCGCACACGGCGGGGCGG + Exonic
1118955632 14:70477787-70477809 CCACCTCCCTCCCGGCGGGGCGG - Intergenic
1119731948 14:76956668-76956690 CCCCCTCGCCCGCCGCGGGCCGG + Intergenic
1120167817 14:81220162-81220184 CGCCCTCCCTCCCGGCGGCCGGG + Intronic
1122736752 14:103847753-103847775 CGTCCGCGCTCCCGGCGGCGGGG + Intergenic
1124616995 15:31249078-31249100 CGCCCTCGCTGGCTGCAGGGAGG - Intergenic
1128089768 15:64911711-64911733 CGGCCTCGGGCGCGGAGGGGTGG + Intronic
1129644669 15:77419652-77419674 CGCCCCCGGGCGCGGCTGGGAGG - Intronic
1131290089 15:91099868-91099890 CCCCCTCGCCCTAGGCGGGGTGG + Intergenic
1132552795 16:560311-560333 CGACCGCGCTCGCGGCGGGAGGG - Intergenic
1137531761 16:49282406-49282428 CGCGTGCGCGCGCGGCGGGGCGG + Intergenic
1140664128 16:77212871-77212893 CCCCCGCGCTCGCGACGAGGAGG + Exonic
1142395315 16:89828450-89828472 GGCGCTCGCGCGGGGCGGGGCGG + Intronic
1143708618 17:8718163-8718185 CGCCCACGGTGGCGGCGGGGAGG + Intergenic
1144211319 17:13017850-13017872 CGCGGCCGCTCGCGGCGGGCGGG + Exonic
1148445209 17:47733394-47733416 CCCTCTCGCGCGCGGAGGGGCGG + Exonic
1148838429 17:50478899-50478921 AGCCCGGGCTCGCGGCTGGGCGG + Exonic
1149626354 17:58083349-58083371 CGGCGGCGCGCGCGGCGGGGGGG + Intergenic
1152461769 17:80445551-80445573 CCCCCGCGCTCCCGGCGGGGAGG - Intergenic
1153480831 18:5544143-5544165 CCCCCTCCCCCGCGGCTGGGAGG - Exonic
1157447172 18:47754527-47754549 GGCCCTGGCTCTCAGCGGGGCGG + Intergenic
1158649416 18:59272937-59272959 CGCCGGGGCTGGCGGCGGGGAGG + Exonic
1161101887 19:2425526-2425548 CGCCCTCCCCGGCGGCTGGGCGG - Intronic
1163636138 19:18437970-18437992 CGGCCTCCATCGCGGCGGGCTGG + Exonic
927652311 2:24920088-24920110 GGCCCGCGCTCCCGCCGGGGAGG - Intergenic
948645192 2:239400347-239400369 CGCCCTCACTCCCGGCGGCCCGG + Intronic
948958606 2:241315148-241315170 CGCCCTCCCCCGCGGGGCGGCGG + Intronic
1171346486 20:24469765-24469787 CGCCCGCCCCCGCGGCCGGGAGG - Intronic
1175215513 20:57390105-57390127 TGCCCTGGCTGCCGGCGGGGAGG - Intergenic
1177431573 21:20997713-20997735 TCCCCTCTGTCGCGGCGGGGTGG + Intergenic
1178673823 21:34614652-34614674 CGGCCGCGCGCGGGGCGGGGAGG - Intronic
1181457904 22:23070199-23070221 GGCCGGCGCTCGTGGCGGGGCGG + Intronic
1181631897 22:24155980-24156002 CTCTCTCGCTCGCGGCGGGCCGG - Intronic
1182544968 22:31069770-31069792 CACCCTCGCTCAGGGCTGGGTGG + Intronic
1184086831 22:42270463-42270485 CGCCCGGGCCGGCGGCGGGGCGG + Intronic
1185395014 22:50582439-50582461 CGCCCGCGCCTGGGGCGGGGCGG - Intronic
950386413 3:12663873-12663895 CTCCCTCACCCGCCGCGGGGAGG - Exonic
955387586 3:58491963-58491985 CGCCCGCGCTCGTGGCGCCGCGG + Intergenic
962318558 3:134373660-134373682 CGCCCGGGCTCGTGGTGGGGCGG - Intronic
965590613 3:170357568-170357590 CGCCCTCGCTCTCCCCCGGGCGG + Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
969716827 4:8871867-8871889 CGGCCTCACTGGGGGCGGGGAGG + Intergenic
973279113 4:48341373-48341395 GGCGCCAGCTCGCGGCGGGGCGG - Exonic
985315983 4:188659293-188659315 CGCGCCCCCACGCGGCGGGGCGG - Intergenic
985611659 5:892749-892771 CGCCCGCGCTCGCTGCGCCGAGG + Exonic
985987090 5:3524858-3524880 AGCCCTTGCACGCGGCTGGGGGG + Intergenic
992550128 5:77851926-77851948 CCCGGTCGCTCGCGGCGCGGAGG + Intronic
996623364 5:125538040-125538062 TGCCCTCGCTGGAGGCTGGGAGG + Intergenic
998401326 5:141850506-141850528 TGCGCATGCTCGCGGCGGGGTGG + Intergenic
998583235 5:143402764-143402786 CGCGCTCGGGCGCGCCGGGGTGG + Intronic
998583639 5:143404288-143404310 CGGCCGCGCTCGGGGCCGGGCGG + Intronic
1000345847 5:160312631-160312653 CGCCCCCGCGCCCCGCGGGGCGG + Intronic
1004924381 6:20403440-20403462 CGCCCTCCGTCGCCGGGGGGCGG - Intronic
1006845000 6:37055953-37055975 CTCCCTTCCTCTCGGCGGGGGGG - Intergenic
1007521389 6:42453363-42453385 CGCCCCCGCCCGCGCCGCGGAGG - Intergenic
1015376131 6:132512797-132512819 CGCCCTTGCACCCGGCCGGGGGG + Intronic
1027183775 7:75957500-75957522 CGTCCTCACTCACGGCGGTGGGG - Intronic
1029413513 7:100429740-100429762 CGTGCGCGCTCGCGGCCGGGTGG + Exonic
1030347952 7:108455281-108455303 CGCCCACCCGCGCGGCGTGGAGG + Intronic
1032011664 7:128351539-128351561 CGCCATCGCTCGCGGGGACGCGG - Exonic
1034977666 7:155457767-155457789 CGCCCCGGCCCGCAGCGGGGCGG + Intergenic
1034978019 7:155459083-155459105 CGTCCCGGCTCGCCGCGGGGAGG + Intronic
1035708419 8:1695138-1695160 CTCCCTCGCCCGCAGCTGGGTGG - Intronic
1036789734 8:11709538-11709560 CGCCCACGCGCTCGGCCGGGTGG - Intronic
1043873855 8:85463858-85463880 TCCCCGCGCTCGGGGCGGGGCGG - Exonic
1049557775 8:143291574-143291596 CGCTCTCGGGCGCGGCGTGGGGG + Exonic
1050744256 9:8858138-8858160 CTCCGCCGCTCGCGGCTGGGGGG + Intronic
1052807519 9:33025683-33025705 CGTGCTCGCTCGGGGTGGGGGGG + Intronic
1056604578 9:88076388-88076410 CGCGCTCGCTGGCGGGAGGGCGG - Intergenic
1057314251 9:93958667-93958689 CGCCCTCCCTAGCAGCCGGGCGG + Intergenic
1062448109 9:136604210-136604232 CGTCCTGGCCCTCGGCGGGGTGG + Intergenic
1187900818 X:24025503-24025525 CGCCCTCTCTCCCAGCGTGGCGG - Intronic
1188811334 X:34657049-34657071 CGTCCTCGCCTGCGGCGGGGCGG - Exonic
1189197256 X:39162652-39162674 CGGCCTCGCTCGCTGGGGGAAGG + Intergenic
1200097976 X:153673115-153673137 TGCCCTTGCCCCCGGCGGGGCGG - Intronic