ID: 1116452989

View in Genome Browser
Species Human (GRCh38)
Location 14:45084731-45084753
Sequence CAGCACCCACAGCTTTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116452989 Original CRISPR CAGCACCCACAGCTTTTGGC AGG Intronic
900123980 1:1061469-1061491 CAGCACCCACAGGTCCTGGCTGG - Intergenic
900495319 1:2973459-2973481 CCGCAGGCACAGCTCTTGGCGGG + Intergenic
900846908 1:5111288-5111310 GAGCACCTAGAGCTTGTGGCTGG + Intergenic
900958191 1:5901364-5901386 CAGCAGCCGCAGCTTGTGGGAGG - Intronic
903646201 1:24897691-24897713 CAGCCCCCACAGCTTGAGGTTGG - Intergenic
903774215 1:25782459-25782481 CAGCACCCCCACCCCTTGGCTGG - Intronic
906086757 1:43142616-43142638 CAGCATCCTCAGCATTGGGCGGG + Intergenic
908757834 1:67485376-67485398 AAGCACTCACATCTTTTGGGAGG - Intergenic
909213781 1:72859091-72859113 CAGGACCCAGTGTTTTTGGCTGG + Intergenic
912123713 1:106506547-106506569 CAGAACCTTTAGCTTTTGGCGGG - Intergenic
915766083 1:158364193-158364215 GAGCCCCCACAGCTTTTGCCAGG - Intergenic
917482457 1:175423923-175423945 CAAGGCCCATAGCTTTTGGCTGG - Intronic
917773021 1:178301066-178301088 TGGAACCCAGAGCTTTTGGCTGG + Intronic
919770940 1:201158140-201158162 CAGCACCCACAGTCCTTGCCTGG - Intronic
919981497 1:202644898-202644920 CAGCACCCGCTGCTCCTGGCCGG + Intronic
920069055 1:203289533-203289555 CAGCACCCAGAGCTTGGGGATGG + Intergenic
920959919 1:210655106-210655128 CAGCTGCCGCAGCTTCTGGCTGG - Intronic
921614609 1:217251486-217251508 CAGCACCTGCAGCTTTTCTCTGG - Intergenic
924115658 1:240743641-240743663 CAGAACCTCCAGCTCTTGGCTGG + Intergenic
1063123631 10:3122329-3122351 CAGCAGCCACAGCATTCGCCAGG - Intronic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1071135135 10:82445062-82445084 CAGCACACAAAGCATTTGGAAGG + Intronic
1072336409 10:94402533-94402555 CAGCACCCAGAGCTGTTCTCTGG + Exonic
1075547933 10:123369506-123369528 CCCCACCCCCAGCTTCTGGCTGG - Intergenic
1077858528 11:6154097-6154119 CAGCCCCCACTGCTGGTGGCAGG + Intergenic
1078348550 11:10573476-10573498 CAGCTCCCACTGCTTCAGGCTGG + Exonic
1080425190 11:32148353-32148375 CTGCACACACTGCTTTTTGCTGG - Intergenic
1080479694 11:32633713-32633735 CAGCACCCAAAGTTTTTTGGGGG + Intronic
1085317496 11:75554463-75554485 AAGCACCCAGCGCTGTTGGCTGG - Intergenic
1086342139 11:85857506-85857528 AAGTACCCACAGCTCTTGTCGGG + Intronic
1088215072 11:107498575-107498597 CAGCACCCACAGTTTTTATTAGG + Intergenic
1088736975 11:112735864-112735886 CAGCAGCGGCAGCTTTTGCCAGG - Intergenic
1096331346 12:50715810-50715832 CAGAACCCCCAGTTTTTAGCTGG - Intronic
1101552223 12:105773600-105773622 AAACACCAACAGCTTCTGGCAGG - Intergenic
1104914348 12:132257114-132257136 CACCTCCCACAGTTTTTGGCAGG - Intronic
1105271773 13:18883265-18883287 CATCACCAACAACTTCTGGCCGG - Intergenic
1105783943 13:23729132-23729154 CAGCTCACACAGCCTTGGGCAGG - Intergenic
1107719613 13:43234179-43234201 CAGAAACTGCAGCTTTTGGCAGG + Intronic
1109132392 13:58603681-58603703 CAGCTCCCTCAGCCTTTTGCAGG - Intergenic
1113321131 13:109233412-109233434 CAGCTCCACCAGCTTCTGGCAGG - Intergenic
1113412484 13:110102341-110102363 TATCACCCACGGCTATTGGCAGG - Intergenic
1114414559 14:22532515-22532537 CAGCACCCTCACCTTTGGGAAGG + Intergenic
1116452989 14:45084731-45084753 CAGCACCCACAGCTTTTGGCAGG + Intronic
1118224759 14:63888351-63888373 CAGCACACACAGCTGCTGGCTGG - Intronic
1118328314 14:64796490-64796512 CAGAGCCCCCAGCTCTTGGCTGG - Intronic
1118844094 14:69533341-69533363 CACCAACCACAGCTTTTGCCAGG - Intergenic
1119383890 14:74245441-74245463 CAGCACCCACCTCATGTGGCAGG - Intronic
1121865200 14:97356339-97356361 CTTCACCCACAGCCTTTGGAAGG + Intergenic
1122023694 14:98859450-98859472 AAGCTCCCACAGCTTGGGGCTGG - Intergenic
1122132468 14:99612824-99612846 CAGCCCCCACAGCCTCTGGACGG + Intergenic
1122528505 14:102407396-102407418 CAGCAGGCACAGCCTCTGGCAGG + Exonic
1122770908 14:104097252-104097274 CTGCAGCCACAGCTGTTGGTGGG + Intronic
1123109951 14:105862231-105862253 CGGCACCCACAGCAGGTGGCAGG - Intergenic
1124667626 15:31607301-31607323 CAACACCCCAGGCTTTTGGCTGG + Intronic
1125256845 15:37774356-37774378 CAGCACCCACAGTGGTGGGCAGG + Intergenic
1126599860 15:50417806-50417828 AAGTACCCACAGCTCTTGTCGGG + Intergenic
1126725591 15:51628418-51628440 CAGGACCCTCAGTTTTTAGCTGG + Intergenic
1128785907 15:70397027-70397049 CAGCTCCAACAGCTTTTGTTGGG + Intergenic
1129256485 15:74336910-74336932 CAGATCCCACAGCTTCGGGCAGG + Intergenic
1129341685 15:74890439-74890461 GAGCACCCCCAGCTCTTGCCTGG + Intronic
1129955390 15:79631558-79631580 CAGCATCCACAAACTTTGGCAGG + Intergenic
1130227381 15:82069618-82069640 CAGAACCAACTGCTTTTGGTGGG - Intergenic
1131164511 15:90132767-90132789 CAGCACCCACAGATACTGTCAGG + Intergenic
1132404991 15:101536597-101536619 CTGCTCCCACAGCTCTGGGCTGG - Intergenic
1133610877 16:7432162-7432184 TGGCACCCAGAGCTTTTGCCTGG + Intronic
1135630555 16:24032966-24032988 CAGCACCCACAGGTTTGTGCTGG + Intronic
1135809398 16:25573955-25573977 CAGTTCCCACAGGGTTTGGCTGG + Intergenic
1136988359 16:35134805-35134827 CAGCCCCAGCAGCTTTTGGTTGG + Intergenic
1138103722 16:54275351-54275373 CAGCACCCACAGCATCAGCCTGG - Intergenic
1141488512 16:84356379-84356401 CAGCACCTACAGATTTTTGAAGG - Intergenic
1142186391 16:88696754-88696776 GAGCAGCCACAGCCTGTGGCTGG + Exonic
1144659049 17:17056538-17056560 CAGGGCCCACAGCTGCTGGCTGG - Intronic
1149921622 17:60665800-60665822 CAAGACTCACAGCTGTTGGCAGG + Exonic
1150213346 17:63453602-63453624 CAGGGCCCACAGCTGTTGGAAGG + Intergenic
1151384712 17:73748000-73748022 CAGCTCCCCCAGTTTCTGGCTGG + Intergenic
1151458204 17:74239254-74239276 CAGCAGCCCCAGCCTTTGGAGGG + Intronic
1151909280 17:77071174-77071196 TAGCACCCTCAGCTTTCGGGAGG - Intergenic
1151961107 17:77406056-77406078 CTGCACCCACAGCTCTGGGGTGG - Intronic
1153775812 18:8452521-8452543 CAGCACCCACAGCTTCCCTCAGG + Intergenic
1153786109 18:8537005-8537027 CAGCAGTCACAGCTGCTGGCAGG - Intergenic
1154203163 18:12314061-12314083 CAGCAGCCACAGCTTCTTTCTGG + Intronic
1155379734 18:25206842-25206864 CAGCACCCACAGCATTGTGTGGG - Intronic
1155657899 18:28211981-28212003 CAGCCCCCACCTCTTTGGGCAGG - Intergenic
1157337542 18:46752621-46752643 CTGCAACCAGAGCTTTTGGGAGG - Intronic
1160917373 19:1503671-1503693 CAGCACCCGCGGCCCTTGGCTGG + Intergenic
1160978742 19:1806854-1806876 CTGGACCCACTGCTATTGGCGGG + Intronic
1161768853 19:6220767-6220789 CAGCAACCACAGCCCTGGGCAGG - Intronic
1162761036 19:12888220-12888242 CACCACTCACAGCTTTTTGTTGG - Intergenic
1163015297 19:14450918-14450940 CAGCAGCCCCAGCTTCTGGTTGG - Exonic
1166777474 19:45321922-45321944 CAGCACCCAAGGTCTTTGGCGGG - Intronic
925093165 2:1171556-1171578 CAGCACCCAGAGCGTTTCACAGG - Intronic
927082700 2:19646261-19646283 AAGCACCCGCAGCATTTGGGAGG - Intergenic
934678202 2:96265126-96265148 CAGCACCCTCACCTTTCAGCAGG + Exonic
935015903 2:99181743-99181765 CAGAACAAACAGCTTTTGGTAGG - Intronic
935278746 2:101499023-101499045 CTGCACTCACAGCTATTGGGAGG - Intergenic
935391131 2:102553815-102553837 CAGCAGCCACAGCCTTTGAAGGG + Intergenic
935544267 2:104384234-104384256 CAGCAAACAGAGCTTTTGGTGGG - Intergenic
937197293 2:120170426-120170448 CACCAGCCAGAGCTCTTGGCAGG + Intronic
938243017 2:129757630-129757652 GTGGACCCACAGCTGTTGGCCGG - Intergenic
948158561 2:235804859-235804881 CAGCACCCACGGCGTCTGCCAGG - Intronic
1171464297 20:25317014-25317036 CAGCACCCACACCTGTTCCCTGG - Intronic
1175387482 20:58606450-58606472 GAGCTCCCACAGCCTGTGGCAGG - Intergenic
1179042919 21:37820368-37820390 CAGCACACCCAGCTTTGAGCAGG - Intronic
1180148782 21:45937012-45937034 CAGCACCCCCAGATTTTGTGGGG + Intronic
1182150640 22:28024797-28024819 CAGCTGCAACAGCTGTTGGCAGG + Intronic
1183398756 22:37588759-37588781 CCCCACCCCCAGCTTCTGGCAGG + Intergenic
1183601172 22:38841414-38841436 CAGCACCTGCAGCATTTGGCAGG - Intronic
1184642286 22:45879093-45879115 CAGCAGCCTCATCTTCTGGCTGG - Intergenic
1184762021 22:46550271-46550293 CAGCACCCACTCCTTCAGGCCGG + Intergenic
950428731 3:12938813-12938835 CAACACACACAGGTTTGGGCAGG - Intronic
950580578 3:13859320-13859342 AAGGTCACACAGCTTTTGGCAGG - Intronic
952344055 3:32467871-32467893 CAGCAGGCACAGCTGTTGGCCGG - Intronic
952387789 3:32855423-32855445 CTGTGCCCACAGCGTTTGGCTGG - Intronic
952951238 3:38527041-38527063 CAGCACCCACAACATGTGCCGGG - Intronic
954899252 3:54005115-54005137 CAGCTCTCGCAGCATTTGGCAGG - Intergenic
956876654 3:73470587-73470609 CAGCATCCACAGCACATGGCGGG - Intronic
957191027 3:77010287-77010309 CAACACCCTCATCTTTTGCCTGG + Intronic
961523441 3:127481725-127481747 CAGCAGCCACAGCGAGTGGCAGG - Intergenic
961537199 3:127577324-127577346 TAGCACCAACAGCCTTGGGCTGG + Intronic
961811429 3:129523934-129523956 CAGCACCCACACCTTGTGTCGGG - Intergenic
966438911 3:179921801-179921823 CAACTCCTACACCTTTTGGCAGG + Intronic
967147394 3:186617583-186617605 CAGCAGCCACAGCTGCCGGCAGG + Intronic
968706346 4:2080210-2080232 CAGCACCCCCAGGCCTTGGCTGG + Intronic
976676323 4:87707754-87707776 CAGCAGGCACTGCTTTAGGCAGG - Intergenic
977470747 4:97438475-97438497 CAGCTCCCTCAGCTTGCGGCAGG - Intronic
979263876 4:118679244-118679266 TAGTACCCATAGCTTTTTGCAGG - Intergenic
980622215 4:135322574-135322596 CAGAACCAACAGATGTTGGCAGG + Intergenic
981159012 4:141474613-141474635 CAGCAACCACTGCTTTAGCCGGG - Intergenic
984398261 4:179227951-179227973 CAGAACACACTGCATTTGGCAGG - Intergenic
985613737 5:906788-906810 AAGCATCAAGAGCTTTTGGCAGG - Intronic
985953054 5:3237869-3237891 CAGCACTCACAGCATGGGGCAGG + Intergenic
986652570 5:9979303-9979325 AAGCACCCACAGATTTTTGTAGG + Intergenic
989460669 5:41694998-41695020 CAGCACACAAAACTTTTGGTTGG + Intergenic
992385909 5:76284579-76284601 CAGCAGCCACAGCTCTTGTCAGG - Intronic
993319268 5:86452793-86452815 CTTCACCCTCAGCTTTTGGGGGG - Intergenic
995086613 5:108118341-108118363 CAGCACAAACAACTTTTGGATGG - Intronic
997751546 5:136350950-136350972 GAGCACCCTCAGATTTTGGTAGG - Intronic
999175718 5:149630463-149630485 CAGCACTCACAGCCTGCGGCAGG - Intronic
999826014 5:155274427-155274449 TAGCACCCACAGCTGTTGCTAGG + Intergenic
1001564189 5:172688929-172688951 GAGACCCCACAGCTTGTGGCTGG - Exonic
1001923800 5:175621485-175621507 CAGCATCTACTGCTTTTGGTGGG - Intergenic
1002466478 5:179411337-179411359 CAGCCCCCACAGCTATTGCCTGG + Intergenic
1002770101 6:283035-283057 CAGCAACCACTGCTTCTGGTGGG - Intergenic
1002959956 6:1905298-1905320 CAGCACCCACAGCTATGTGCTGG - Intronic
1002959969 6:1905367-1905389 CAGCACCCACAGCTATGTGCTGG - Intronic
1002959982 6:1905436-1905458 CAGCACCCATAGCTATGTGCTGG - Intronic
1002959996 6:1905505-1905527 CAGCACCCACAGCTATGTGCTGG - Intronic
1002960008 6:1905574-1905596 CAACACCCACAGCTATGTGCTGG - Intronic
1002960021 6:1905643-1905665 CAGCACCCACAGCTATGTGCTGG - Intronic
1002960035 6:1905712-1905734 CAGCACCCATAGCTATGTGCTGG - Intronic
1002960048 6:1905781-1905803 CAGCACCCACAGCTATGTGCTGG - Intronic
1002960061 6:1905850-1905872 CAGCACCCACAGCTATGTGCTGG - Intronic
1004342612 6:14820692-14820714 CAGCATACACAGATATTGGCAGG - Intergenic
1004345479 6:14845097-14845119 AAACACACACAGATTTTGGCCGG + Intergenic
1006993060 6:38232105-38232127 GAACCCCTACAGCTTTTGGCTGG - Intronic
1007722651 6:43894481-43894503 CAGAATTCACAGCTTCTGGCAGG + Intergenic
1008088026 6:47264689-47264711 AAGCACCCAAAACTGTTGGCAGG - Intronic
1010294799 6:74183140-74183162 CAGCACCCAGAGCGGCTGGCTGG + Intergenic
1010644046 6:78365192-78365214 CAGCACCCAAAGCAGCTGGCTGG + Intergenic
1012401633 6:98846320-98846342 AAGGAGCCTCAGCTTTTGGCAGG + Intergenic
1014080679 6:117282800-117282822 CTGCAGGCAGAGCTTTTGGCAGG - Intergenic
1014364941 6:120527863-120527885 TTGCTTCCACAGCTTTTGGCAGG + Intergenic
1019364326 7:624093-624115 CAGCACCCGCAGGTTTAGGTTGG + Intronic
1020899554 7:13988708-13988730 CTGCACTCAAAGTTTTTGGCTGG - Intronic
1023033632 7:36111899-36111921 CAAAACCAACAGCTTCTGGCTGG + Intergenic
1024778727 7:52821568-52821590 CAGCACCCACAGCTGTTTCATGG + Intergenic
1027264629 7:76487585-76487607 CAGCACACACGGCTTTGAGCGGG + Intronic
1027316001 7:76985687-76985709 CAGCACACACGGCTTTGAGCGGG + Intergenic
1032073124 7:128821950-128821972 CACCACCCTCAGCTTTGGGCAGG + Exonic
1032325951 7:130928251-130928273 CAGCACACACAGCCCTTTGCTGG + Intergenic
1032551553 7:132789037-132789059 CAGAACTCAGGGCTTTTGGCTGG + Intronic
1033914128 7:146302950-146302972 TAGCAGACACAGCTTTTGGCTGG + Intronic
1034256446 7:149727256-149727278 CAGCAGCCACAGCTCTGGCCAGG + Intronic
1034295255 7:149966744-149966766 CATCAGCCAAAGCTGTTGGCAGG - Intergenic
1034810807 7:154130204-154130226 CATCAGCCAAAGCTGTTGGCAGG + Intronic
1036560170 8:9894986-9895008 GAGCACCCCAAGCTTTTGGCAGG - Intergenic
1037727640 8:21496189-21496211 CAGAAGACACAGCTTTTGGCAGG - Intergenic
1037887160 8:22601170-22601192 CACCTCCCCCAGCTTCTGGCTGG - Exonic
1042006186 8:64182727-64182749 CACCACCCACATCTCTTGGCTGG + Intergenic
1045351543 8:101345268-101345290 CAGCACCCTAAGATTTTGGGGGG - Intergenic
1046482906 8:114846665-114846687 CAGCTCCCTCACCTTTTGGCTGG - Intergenic
1047491889 8:125382026-125382048 CTGCACCCACAGCTGTTGGGAGG - Intergenic
1049283855 8:141764035-141764057 CTGCTCCCACAGCTATAGGCAGG + Intergenic
1055426722 9:76204326-76204348 CAGTAGCCACAGGTTTTAGCAGG - Intronic
1057276024 9:93676397-93676419 CAGCACCCACAGCAGCTGCCTGG - Intronic
1058483471 9:105420204-105420226 CATCACCCCAAGGTTTTGGCAGG + Intronic
1061719672 9:132543834-132543856 CATCTTCAACAGCTTTTGGCAGG + Intronic
1062309486 9:135928420-135928442 CAGGTCCCAGAGCTTTTGTCAGG + Intergenic
1185785206 X:2885084-2885106 CATCAGCCAAAGGTTTTGGCAGG - Intergenic
1187051727 X:15702849-15702871 CAGAACCCAGTGCTTTTGGGCGG - Intronic
1187262203 X:17696122-17696144 CAGAAACTACAGCTTTAGGCTGG + Intronic
1188422697 X:30009046-30009068 CAGCACTCCAATCTTTTGGCTGG + Intergenic
1189605594 X:42674357-42674379 CAGGAACCACATCTTTTGCCAGG + Intergenic
1192167998 X:68838055-68838077 GAGCTCCCCCAGCCTTTGGCTGG + Intronic
1193061545 X:77213445-77213467 CAGCACACACAGTTTCTAGCAGG - Intergenic
1195799834 X:108695389-108695411 CAACTCCTACAGCTTTTGGCTGG + Exonic
1198602415 X:138297605-138297627 AAGGACCCACAGCTTTTTTCCGG - Intergenic
1199280631 X:145995826-145995848 CACCAAACACAACTTTTGGCTGG - Intergenic
1200988488 Y:9327132-9327154 CAGCACACCCAGATGTTGGCCGG + Intergenic
1201305025 Y:12542584-12542606 CAGCATCCAGATCTTTTGTCTGG - Intergenic