ID: 1116458363

View in Genome Browser
Species Human (GRCh38)
Location 14:45144306-45144328
Sequence TAGTGGGCGAGGGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 546}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116458363 Original CRISPR TAGTGGGCGAGGGGGGTGGA GGG (reversed) Intronic
900922845 1:5684632-5684654 AAGTGGGCCTGGGGGATGGAGGG - Intergenic
901261788 1:7876504-7876526 TAGTGGGCTAGGTGGGTGAGTGG - Intergenic
901619160 1:10568326-10568348 TAGTGGGAGTGGGGGGGGGGGGG - Intronic
901650349 1:10739530-10739552 GAGTGGGCCCGGGGGGCGGAGGG - Intronic
901897557 1:12327462-12327484 TGGTGGGGGTGGGGGGTGGGAGG - Intronic
902289829 1:15428763-15428785 TGGTGGGCGAGGGTGGCGCATGG + Exonic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
902920837 1:19665298-19665320 AGGTGGGTGAGGGGGGTGAATGG - Exonic
903651877 1:24927562-24927584 CAGTGGGCGAGGTAAGTGGAAGG - Exonic
904255964 1:29255093-29255115 TAGAGGGAGAGGGTGGAGGAGGG + Intronic
904582325 1:31553846-31553868 GAGTGGGGGAGGGGGGTGGAAGG - Intergenic
904788267 1:32998716-32998738 CAGGGGGTGATGGGGGTGGAGGG - Intergenic
905263081 1:36732767-36732789 CAGTGAGGGAGTGGGGTGGAAGG + Intergenic
905793998 1:40805243-40805265 TGGTGGGGGAGAGGGGAGGAGGG - Intronic
905966683 1:42104423-42104445 CAGTGGGCGAGGGAGGAAGAGGG - Intergenic
906143534 1:43547179-43547201 TGGTGGGTGAGTGGGGTGGGTGG - Intronic
906210571 1:44010449-44010471 TTGTGGGCGGGGGGGGGGGGGGG + Intronic
906423047 1:45686862-45686884 AAGTGGGCAAGGGGGTTAGAAGG - Intronic
906644412 1:47463552-47463574 TTGTGGGCGATGAGGTTGGAAGG + Intergenic
907053034 1:51342595-51342617 TGGTGGGCGAGGGGTGAGGGTGG + Intronic
907733838 1:57092664-57092686 TGGCGGGGGAGGGGGGTGGGGGG + Intronic
907933950 1:59025512-59025534 TGGTGGGCGTGGGGAGGGGAAGG - Intergenic
908224682 1:62044276-62044298 TAGTGGGAGGGGCTGGTGGATGG - Intronic
908615964 1:65922996-65923018 TTGTGGGGGAGGGGGTTGGGGGG - Intronic
909355261 1:74701216-74701238 TGGTGGGGGAGGGGGAGGGAGGG - Intergenic
911406681 1:97449427-97449449 AAGTGGGAGAGGGAGGTGGGAGG + Intronic
911849660 1:102802058-102802080 CAGTGGGAGATGGGGGTGAACGG - Intergenic
914530776 1:148522494-148522516 TGGTGGGGGGGGGGGGTGGGGGG + Intergenic
915267492 1:154729326-154729348 CATGGGGCGAGGGGAGTGGATGG + Intronic
915495416 1:156279219-156279241 TGGTGGGCGGGGGGTGGGGAGGG - Intronic
915500999 1:156317619-156317641 ACGTGGGAGAGGTGGGTGGAAGG - Intronic
915532672 1:156512134-156512156 GCGTGGGGGTGGGGGGTGGAAGG + Intergenic
916053655 1:161052863-161052885 TAGTTGGCGAGGGGTGATGAAGG - Intronic
916096155 1:161352716-161352738 AAGTGGCCGAGGTGGGTGGGAGG + Intronic
916420724 1:164635319-164635341 TGGGGGGCGAGGGGGGAGGGAGG + Intronic
916571178 1:166029102-166029124 CAGTGGGGCAGCGGGGTGGAGGG + Intergenic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917859509 1:179132852-179132874 TGGTGGGAGAGGGGTGCGGACGG - Intronic
917984521 1:180302036-180302058 TATTGGGGGGGGAGGGTGGAGGG + Intronic
918245653 1:182657087-182657109 AGGTGGGCCAGGGGGGTGGGTGG - Intronic
918610025 1:186478753-186478775 TGGTGGGAGAGGGGTGAGGAAGG + Intergenic
919518028 1:198551027-198551049 TAGTGGGAGAAGGAGGAGGAAGG + Intergenic
919776476 1:201197391-201197413 TAGTGAGGGAGGGGAGGGGAGGG + Intronic
920788076 1:209061898-209061920 TAGGGAGTGAGGGGGGTTGATGG + Intergenic
920945224 1:210522763-210522785 TAGTGGGATTGGGGGGTGGGGGG - Intronic
921183019 1:212646188-212646210 GAGTGGGAGAAGGGGGCGGAGGG - Intergenic
922178069 1:223212540-223212562 TGGTGGGAGGTGGGGGTGGAGGG + Intergenic
922416149 1:225425211-225425233 TAGTGGGAGAGTGGGGGGGGAGG + Intronic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
923174720 1:231453558-231453580 AAGTGGGAGAGGGAGGGGGAGGG - Intergenic
923706678 1:236349814-236349836 TGGTGGGGGAGGGTGGTGGCAGG + Intronic
924178683 1:241419141-241419163 TTGTGGGCGGGGGTGGCGGAGGG + Intergenic
924233990 1:241985409-241985431 AAGTGGGCGGGGTGGGTGGTGGG - Intergenic
1062934657 10:1376856-1376878 TGGTGGGGCAGGGGGGTGGGTGG + Intronic
1063154948 10:3370603-3370625 GTGGGGGCGGGGGGGGTGGAGGG - Intergenic
1063282198 10:4642435-4642457 TAGTGGGGTTGGGGGGTAGATGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1065673989 10:28154736-28154758 TAGTTGGGGTGGGGGGTGGTGGG + Intronic
1066134158 10:32426675-32426697 TAGAGAGAGAGGGGGGTGGGGGG + Intergenic
1066468268 10:35672047-35672069 ATGTGGGGGCGGGGGGTGGATGG + Intergenic
1067411012 10:46064638-46064660 AAGTGGGAGAGTAGGGTGGAAGG - Intergenic
1067759102 10:49029905-49029927 TGGTGGGAGAGGGTGATGGAGGG + Intronic
1069920582 10:71813178-71813200 GAGTGGGCGAGGGGCGGGGCAGG + Intronic
1069941875 10:71962180-71962202 TGGTGGGAGACGGGGGTGGTGGG + Intergenic
1070649593 10:78225310-78225332 AAGTGGGGGAGGGGAGTTGATGG + Intergenic
1070794735 10:79210049-79210071 TAGGGGGCTGGGGGGGCGGAGGG - Intronic
1070924052 10:80206524-80206546 GAGTGGGCTGGGGGAGTGGAGGG - Intergenic
1073359858 10:102889671-102889693 AAAGGGGCGGGGGGGGTGGAGGG - Intronic
1074034534 10:109724955-109724977 TTGTGGGGTAGGGGGGTGGGAGG + Intergenic
1074065060 10:110007058-110007080 GTCTGGGCGAGGGGGGTGGGAGG + Intronic
1074162916 10:110848828-110848850 GGGTGGGTGTGGGGGGTGGAGGG - Intergenic
1075079106 10:119370962-119370984 GAGTGGGGCGGGGGGGTGGAAGG - Intronic
1075318270 10:121469299-121469321 TAGTGGGGGAGCGGGGTGTGGGG - Intergenic
1076050906 10:127332496-127332518 TTGTGGGCAACAGGGGTGGAGGG - Intronic
1076934738 10:133559778-133559800 TAGCGGGTGAGGGGGAAGGAAGG + Intronic
1077207836 11:1352802-1352824 TGGTGGGGGTGGGGGGTGGGGGG - Intergenic
1077216199 11:1396192-1396214 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077216212 11:1396228-1396250 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077216225 11:1396264-1396286 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077347503 11:2070666-2070688 TAGTGGGACAGGATGGTGGAGGG - Intergenic
1078166956 11:8895246-8895268 TTGTGGGGTAGGGGGGTGGGAGG + Intronic
1078222319 11:9362232-9362254 TGGTGGGCGGGGGGGAGGGATGG - Intergenic
1079424884 11:20330650-20330672 TAGAGGGAGAGGCAGGTGGAAGG - Intergenic
1079645912 11:22863644-22863666 TAGTGGCGGAGGGAGGTGGGGGG + Intergenic
1080580789 11:33642040-33642062 TAGTGGGGGAGGGAGGTGCAGGG + Intronic
1080764529 11:35282965-35282987 AAGTGAGCCAGGGGAGTGGAAGG - Intronic
1081679820 11:44994417-44994439 TAGGTGGGGAGGGGAGTGGAAGG - Intergenic
1083160979 11:60853845-60853867 TATTGGGCGGTGGGGGTGGGGGG + Intronic
1083263990 11:61537751-61537773 TGGTGGGCGGGGGGGATGTAAGG - Intronic
1083311021 11:61783791-61783813 TGGTGGGGGTGGGGGGTGGCAGG + Intronic
1083958981 11:66003396-66003418 TAGTGCAAGCGGGGGGTGGAAGG + Intronic
1084395800 11:68909169-68909191 TTTTTGGCGGGGGGGGTGGAGGG + Intronic
1085244715 11:75090909-75090931 TAGTGGGCGGGGGGAAAGGAGGG + Intergenic
1085369654 11:75988904-75988926 AAGTGGGGAAGGGGGATGGATGG + Intronic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1087990657 11:104743098-104743120 TAGTGGGGCAGGGGTGGGGATGG + Intergenic
1088071877 11:105796989-105797011 GGGTGGCCGAGGTGGGTGGATGG + Intronic
1088472218 11:110198679-110198701 GAGTGGGGTTGGGGGGTGGAGGG - Intronic
1088799073 11:113289210-113289232 TAGTGGGGTAGGGGTGGGGAGGG - Intergenic
1089041361 11:115453357-115453379 TTGGGGGCGAGGGGGGTATAGGG - Intronic
1089116456 11:116099167-116099189 TACTGGGGTAGGGGGGAGGATGG - Intergenic
1089884724 11:121808976-121808998 TAGTGAGAGAGGTGGGTGCAGGG - Intergenic
1090239322 11:125170959-125170981 CAGTGGGGGAGGGGGGAGGCTGG + Intronic
1090367905 11:126223156-126223178 GAGTGAGGGAGGGGGCTGGATGG + Intronic
1091195890 11:133730496-133730518 TAGAAGGGGAGGGGGGTGCAGGG - Intergenic
1091413839 12:262959-262981 CAGTGGCCGAGGGGAGGGGAGGG - Intergenic
1092085344 12:5753236-5753258 TATTGGGCTAGTGGGCTGGAGGG + Intronic
1093007118 12:14062723-14062745 AGGGGGGCGTGGGGGGTGGAAGG + Intergenic
1093019943 12:14193950-14193972 AAGTGGGCGACGGGGGCGGGTGG + Intergenic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1093617655 12:21247527-21247549 TAGTGGGAGTAGGGGGTGGATGG + Intergenic
1094317322 12:29148794-29148816 TGGCGGGGTAGGGGGGTGGAGGG - Intergenic
1094337199 12:29372894-29372916 GAGAGGCCGAGGTGGGTGGAAGG - Intronic
1094596517 12:31871359-31871381 AAGTGGGCGCTGGGGGTGAAAGG - Intergenic
1094599761 12:31898203-31898225 GAGTGGGGGAGGGGAGGGGAGGG + Intergenic
1095668987 12:44836020-44836042 GAAAGGGAGAGGGGGGTGGAAGG + Intronic
1095970829 12:47901093-47901115 TTGTGGGCAAGGGGGGTAGGTGG - Intronic
1096355571 12:50938192-50938214 TAGGGGGGTGGGGGGGTGGAGGG - Intergenic
1096597024 12:52702326-52702348 TTGTGGGCTAGATGGGTGGATGG + Intronic
1097319858 12:58213358-58213380 TGGGGGGGCAGGGGGGTGGAGGG - Intergenic
1097686239 12:62693736-62693758 TAGTGGGGGTGGGAGGTGGGCGG - Intronic
1098508395 12:71282162-71282184 AAGTGGGGGAGGGAGGTGGAGGG + Intronic
1101033035 12:100678514-100678536 GAGTGGGAGAGAGGGCTGGATGG - Intergenic
1101046797 12:100814916-100814938 AAGTGGGAGAGGGGGCTGCAGGG + Intronic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101477599 12:105065225-105065247 TAATCGGGGAGGGGGGTGGGGGG + Intronic
1101794610 12:107961356-107961378 TATTGGGGGTGGGGGGTGAAGGG - Intergenic
1101940787 12:109097836-109097858 TAGGGGGTGAAGGGGGAGGAAGG + Intronic
1102053897 12:109881913-109881935 TAGTGGTGGAGGGTGGGGGAGGG - Intergenic
1102308308 12:111823552-111823574 CGCTGGGCCAGGGGGGTGGAGGG + Intergenic
1102790134 12:115637884-115637906 TAGGCAGCGATGGGGGTGGAGGG - Intergenic
1103015224 12:117489165-117489187 TGGTGGGCGGGGGTGCTGGAAGG + Intronic
1103759054 12:123234393-123234415 TTGTGGGGGAGGGGGGTAGGGGG + Intronic
1103800641 12:123534632-123534654 TGGGGGGCGGGGAGGGTGGATGG - Intergenic
1105262680 13:18791554-18791576 TAGTGGGAGTTGGGGGTGGGTGG - Intergenic
1105470804 13:20692997-20693019 AAGTGGGCAAGTGGGATGGAAGG + Intergenic
1105865869 13:24458712-24458734 TAGTGAGTTAGGTGGGTGGAGGG + Intronic
1106516257 13:30456753-30456775 TTGTGGGCGGGGGGGGGGGGTGG + Exonic
1107022737 13:35767872-35767894 TGGGGGGCGTGGGGGGTGGGGGG + Intergenic
1107314248 13:39114144-39114166 TATTGGGGGAGGGGAGGGGAGGG - Intergenic
1107922979 13:45229192-45229214 GAGGGAGCGAGGGGAGTGGAGGG - Intronic
1108714805 13:53068615-53068637 AAATGGGAGAGGGGAGTGGAGGG + Intergenic
1108817859 13:54313673-54313695 TAGCCGGGGAGGGGGGGGGAGGG - Intergenic
1109198313 13:59403610-59403632 TAGTGGGGGACTGGGGTGGGAGG + Intergenic
1109350998 13:61181136-61181158 TTGTGGGCGGTGGGGGTGGGGGG - Intergenic
1110619762 13:77582025-77582047 GAGTGGGGGATGGGGGTGAAAGG + Intronic
1112318349 13:98384917-98384939 TAGTTTGTGTGGGGGGTGGAGGG - Intronic
1112780001 13:102889989-102890011 TAGTGGTAGAGGTGGGTGGTAGG + Intergenic
1113374196 13:109748985-109749007 TAATGGGTGAGTGGGGAGGAAGG + Intergenic
1113566880 13:111324619-111324641 GAGAGGGCAAGGGAGGTGGATGG + Intronic
1113709496 13:112454244-112454266 TCGTGGGGGTGGGTGGTGGAAGG - Intergenic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114502509 14:23181443-23181465 TGGTGGGGGTGGGGGGGGGATGG + Intronic
1114517606 14:23309820-23309842 GAGTGGGAGAGGAGGGTGGCAGG - Exonic
1114814241 14:25937747-25937769 TAGTGGGTGTGGGAAGTGGAAGG + Intergenic
1115604941 14:34991724-34991746 TGTTGGGGGTGGGGGGTGGAGGG + Intronic
1116458363 14:45144306-45144328 TAGTGGGCGAGGGGGGTGGAGGG - Intronic
1118267574 14:64309728-64309750 GAGAGGCCGAGGTGGGTGGATGG + Intronic
1121567747 14:94923490-94923512 GAGGGGGGGAGGGGGGAGGAGGG - Intergenic
1122600697 14:102920273-102920295 TAGTGGGAGTGGATGGTGGATGG - Intergenic
1122840754 14:104461588-104461610 CAGGGGACAAGGGGGGTGGACGG + Intergenic
1122960491 14:105091780-105091802 CAGTGGGCGGGGGTGGAGGACGG + Intergenic
1124245368 15:28066402-28066424 TGATGGGAGAGGGGGGTGGGAGG + Intronic
1124449776 15:29777021-29777043 TATTGAGTGGGGGGGGTGGAAGG - Intronic
1127390405 15:58500735-58500757 TGGGGGGAGAGGGGGGTGGTGGG - Intronic
1127641752 15:60922390-60922412 TAGTGGGAGAGTGGGGGGAAGGG + Intronic
1128697606 15:69780372-69780394 TGGTGGGGCAGGGGGGTGAAGGG - Intergenic
1128980424 15:72181353-72181375 AAGTGGGGCAGGGGAGTGGAGGG + Intronic
1129226721 15:74174507-74174529 TGCTGGGGGAGGGGGGTGGCTGG + Intronic
1129356342 15:74994552-74994574 TGGTGTGGGTGGGGGGTGGAGGG + Intronic
1131839322 15:96418506-96418528 AACTGGGAGAGGGGGGTGGTGGG + Intergenic
1132829008 16:1918491-1918513 GAGTGGGCGGGGGAGGGGGAGGG - Intergenic
1133562961 16:6966496-6966518 TAGGTGGCGAGAGGGGCGGACGG + Intronic
1134042882 16:11081564-11081586 TAGGTGGGGAGGGGAGTGGAAGG - Intronic
1134129433 16:11639218-11639240 TAGAGGGAGAGAGGGATGGATGG + Intergenic
1134197534 16:12170458-12170480 CAGTGGGGGAGGCGTGTGGATGG + Intronic
1134405713 16:13956769-13956791 TTGTGGGGGATGGGGGTGGAGGG + Intergenic
1134823196 16:17263274-17263296 CATTGGCCGTGGGGGGTGGAGGG - Intronic
1135114288 16:19712328-19712350 TAGAGGGGGAGGGGAGTGGAGGG - Intronic
1135552408 16:23408303-23408325 TAGGGGGCGAGTGGGGCGGGAGG + Intronic
1135588862 16:23691241-23691263 GAGTGGGCCTGGGCGGTGGAGGG - Intronic
1136096836 16:27962960-27962982 GAGTGGGAGAGGCTGGTGGATGG - Intronic
1136110697 16:28062564-28062586 GGGTTGGCGATGGGGGTGGAAGG + Intronic
1136218654 16:28812997-28813019 GACTGGGCGAGGTGGGAGGATGG - Intergenic
1136554363 16:30999046-30999068 TTTTGGGGGTGGGGGGTGGAGGG - Intronic
1137652922 16:50135854-50135876 TAGTGGGGGAGGTGGGAGGTAGG - Intergenic
1138134028 16:54506301-54506323 TAATTGGGAAGGGGGGTGGAGGG - Intergenic
1139117663 16:63976246-63976268 GAGTGGGAGATGGGAGTGGAGGG + Intergenic
1140359515 16:74332523-74332545 CAGTGGGGGAGGGGAGGGGAGGG + Intergenic
1140980414 16:80103795-80103817 AAGTGGGTGGGGGTGGTGGACGG - Intergenic
1141752796 16:85970363-85970385 AAATGGGTGAGGGGTGTGGAAGG - Intergenic
1142548169 17:720330-720352 TAGTAGGCGATGGGGGAGGATGG + Intronic
1142669765 17:1482745-1482767 TAGTGTGGGAGGGGAGGGGAGGG - Intronic
1143240968 17:5443114-5443136 GTGTGGGCGGGGGGGGTGGGGGG - Exonic
1143397216 17:6610340-6610362 TGGTAGGGGCGGGGGGTGGAGGG + Intronic
1143709424 17:8724120-8724142 TAGAGGCCAAGGTGGGTGGATGG - Intergenic
1143807993 17:9445501-9445523 TGGTGGGGGAGGGGGTTGGGGGG + Intronic
1143894948 17:10128375-10128397 GAGTGGACGGGAGGGGTGGATGG + Intronic
1145863501 17:28226416-28226438 TGGTGGGAGTGGGGGGTGGGAGG - Intergenic
1146312495 17:31779964-31779986 TAGTGGGGGTGGGGGGTGGGTGG - Intergenic
1146317599 17:31820441-31820463 GAGAGGCCGAGGCGGGTGGATGG + Intergenic
1147315922 17:39620188-39620210 TAGTGGGAGATGGGTGGGGATGG + Intergenic
1147360582 17:39927363-39927385 CAGAGGGAGTGGGGGGTGGAGGG - Intronic
1147421004 17:40322157-40322179 GAGAAGGGGAGGGGGGTGGAGGG + Intronic
1147587546 17:41661032-41661054 GAGTGGGGGTGGGGGGTGGGGGG - Intergenic
1147867094 17:43560194-43560216 TAGTCGGGGAGGTGGGTGGGAGG + Intronic
1148191478 17:45681552-45681574 TAGTGTGGGAGGTGGGTGGAGGG - Intergenic
1148450845 17:47777132-47777154 CAGTGGGTGAGGCTGGTGGAGGG - Intergenic
1148603134 17:48908873-48908895 TAGTGGGAGAGGGTGGGGGGCGG - Intronic
1148747701 17:49927705-49927727 TAACGAGCGAGGGGGGTGGGGGG - Intergenic
1149439295 17:56661724-56661746 AAGTGAGAGAGGGGGCTGGAAGG + Intergenic
1149914922 17:60600164-60600186 TGGTGGGCGCGGGCGGTGGGGGG + Exonic
1150081286 17:62241747-62241769 TAGTGGGGTAGGGGGATGTATGG + Intergenic
1150479769 17:65500072-65500094 TAGTGTGATAGGGTGGTGGAAGG + Intergenic
1150484365 17:65533540-65533562 TTGTGGGCGAGTGGGGAGCAGGG - Intronic
1150956150 17:69862635-69862657 GAGTGGGCGGGGGGCGTGGTGGG - Intergenic
1151013839 17:70531264-70531286 TGGAGGGTGGGGGGGGTGGAAGG + Intergenic
1151408814 17:73907221-73907243 TAGTGGGCAAGGGAGGAGGGAGG + Intergenic
1151750177 17:76032708-76032730 CAGTGGGCGAAGGGAGTGAAGGG - Intergenic
1152930119 17:83105022-83105044 GCGTGGGCGAGAGGGGTGCATGG + Intergenic
1155145978 18:23084076-23084098 TAGTGGGAGGTGGGAGTGGAGGG + Intergenic
1156386061 18:36606349-36606371 TAGAGGGCAAGGGGGTTGTAGGG + Intronic
1157452740 18:47800655-47800677 GAGTGGGCGGGAGGGGTTGATGG - Intergenic
1157521811 18:48350667-48350689 TGGTGGGCGACAGGGGTGGAAGG - Intronic
1157605528 18:48923684-48923706 TAGTGGGGGTTGGGGGTTGAGGG - Intronic
1158260169 18:55597820-55597842 TAGGTGGGGAGGGGGTTGGAGGG - Intronic
1158525914 18:58213596-58213618 TGGTGGGAGAGTGGGGTGGCAGG + Intronic
1158959739 18:62579665-62579687 TAGTGGGGGAAGGGGAGGGAGGG - Intronic
1159213601 18:65362340-65362362 TTGTGGGGGAGGGGGGAGGGAGG + Intergenic
1159325792 18:66915400-66915422 TAGTTGGGGAGGAGGGTGGAGGG + Intergenic
1159686983 18:71434769-71434791 TAGTGGTGGAGGTGGGTGGAGGG + Intergenic
1160505057 18:79422451-79422473 GAGTGGGTGACGGGGGTGGTGGG + Intronic
1160712515 19:559085-559107 TCATGGGGGCGGGGGGTGGAGGG - Intergenic
1160818136 19:1045660-1045682 TGGTGGGGGAGGGGGGCGGGGGG - Intronic
1161497086 19:4592594-4592616 CAGGTGGCGAGGGGGATGGAAGG - Intergenic
1161782024 19:6299200-6299222 GGGTGGGCGGGGGGGGTGGATGG + Intergenic
1161939086 19:7391465-7391487 TAGTGGGAGAGAAGCGTGGAGGG - Intronic
1162188128 19:8922895-8922917 AAGTGGGCGAGGGAGGAGTACGG + Intronic
1162237708 19:9321729-9321751 GAGTGGGGGAGGAGGGTGGCAGG - Intergenic
1162328013 19:10010214-10010236 GAGGGGTGGAGGGGGGTGGAGGG - Intronic
1162955076 19:14092882-14092904 AAGTGGGAGAGGGGGCAGGAGGG + Exonic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163035473 19:14566685-14566707 GGGTGGGCCAGGGGTGTGGAAGG + Intronic
1163145626 19:15377861-15377883 TAGTGGGCGGGGGGTGTGGAGGG - Intronic
1163551451 19:17968062-17968084 TATTGGGGGAGGGGAGGGGAAGG + Intronic
1163635968 19:18437405-18437427 TAGTGGGCGAGGGACCTGCAGGG - Intronic
1163640798 19:18460964-18460986 CCATGGGTGAGGGGGGTGGAAGG + Intronic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164685655 19:30164949-30164971 AAGTGGGGGTGGGGGGTGAAGGG + Intergenic
1164754281 19:30678459-30678481 CAGTGGGCGATGGGGAGGGAGGG - Intronic
1164998715 19:32743352-32743374 GAGTGGGGGAGGGGAGGGGAGGG - Intronic
1165891229 19:39113486-39113508 GAGTGGGCGAGGGGGGTGATTGG - Intergenic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1167056259 19:47112963-47112985 GAGCGAGCGAGGGGGGTGGGGGG + Intronic
1167095667 19:47373809-47373831 TGGTGGGGGAGGTGGGTGCAGGG - Intronic
1168123332 19:54267360-54267382 GAGTGGGGGAGGGAGGGGGAGGG + Intronic
925169908 2:1744156-1744178 TGGGGGGCGCGGAGGGTGGAGGG - Intronic
927275373 2:21258054-21258076 TACAGGGGGAGTGGGGTGGAAGG - Intergenic
927280829 2:21304992-21305014 GAGTGAGAGAGGGGAGTGGATGG + Intergenic
927960849 2:27239809-27239831 TACTGGGCTAGGGGGCTGGGAGG + Intronic
928243390 2:29606016-29606038 CAGTGGGGGTGGGAGGTGGAAGG - Intronic
928491763 2:31791672-31791694 TAGTGGGGGAGGTTGGGGGATGG + Intergenic
929604623 2:43226405-43226427 TAACGGGCGAGGGGCGGGGAGGG + Exonic
929872193 2:45768522-45768544 TAGTTGGCCAGGGGGCTCGATGG + Intronic
930136154 2:47905807-47905829 GAGTGGGAGAGGGGGGAGGAAGG + Intergenic
930218919 2:48726013-48726035 TGGTGGGGGAGAGGGGTGGGAGG - Intronic
930675654 2:54197727-54197749 TAGAAGGCTAGTGGGGTGGAAGG + Intronic
930743242 2:54855454-54855476 TAGAGGGCGGGGGGGGGGCATGG - Intronic
931994608 2:67828028-67828050 AAGTGGGTGATTGGGGTGGAAGG - Intergenic
932356684 2:71073318-71073340 GGGTGGGAGAGGGGGGTGGGAGG - Intronic
932433053 2:71686831-71686853 GGGTGGGCGGGGAGGGTGGACGG + Intergenic
932555442 2:72820022-72820044 TAATGGGAGAGGGTGCTGGATGG + Intronic
934567472 2:95348450-95348472 GGGTGGGCGTGGGGGGTGGCTGG + Intronic
934577981 2:95414970-95414992 GAGTGTGTGAGAGGGGTGGAGGG - Exonic
934615902 2:95770788-95770810 GAGAGGCCGAGGTGGGTGGATGG - Intergenic
934856343 2:97732682-97732704 AAGTGGCAGAGGGCGGTGGAGGG - Intronic
935313454 2:101807766-101807788 GAGTGGGGGAGGGGGAGGGAAGG + Intronic
936025415 2:109027750-109027772 GAGTGGGCGGGGTGGGTGGGCGG + Intergenic
937039385 2:118809128-118809150 TAGGAGGTGAGGGGGGTGGCAGG - Intergenic
938743208 2:134252336-134252358 TAGTGGGAGAGGGGTGTGATGGG + Intronic
940622859 2:156134748-156134770 TGGTGGTGGTGGGGGGTGGAGGG - Intergenic
941047328 2:160691194-160691216 CAGTGGGGGTGGGAGGTGGAGGG + Intergenic
942307321 2:174621499-174621521 GTGTGGGCGATGGGGGTGGAGGG - Intronic
943694434 2:190909464-190909486 AAGTGGGGGAGGGGGGAGAAGGG - Intronic
944530927 2:200667445-200667467 TGGTGGGGGCGGGGGGTGGGGGG - Intronic
944765744 2:202862595-202862617 GGGAGGGCGAGGCGGGTGGATGG + Intronic
945296358 2:208175038-208175060 TGGAGGCCGAGGGGGGTGGGTGG + Intronic
945731509 2:213541904-213541926 TAGTAGGCCTGGGGAGTGGATGG + Intronic
945769840 2:214029471-214029493 TAGTGGGCGGGGAGAGGGGAAGG + Intronic
945993177 2:216413143-216413165 TGGTGGGGGAGGGGGGAGGGGGG + Intronic
947023146 2:225705959-225705981 TAGTGGGGGAGGGTGCTTGAAGG - Intergenic
947727919 2:232411096-232411118 TAGAGGGTGGGGGTGGTGGAGGG + Intergenic
948072423 2:235138527-235138549 TAGTGGGTGAGCTGGGTGGGAGG + Intergenic
948122694 2:235543094-235543116 CAGGGGGCGGGGGGGGGGGAGGG - Intronic
948383547 2:237567684-237567706 ATGTGGGGGAAGGGGGTGGATGG - Intergenic
948528661 2:238589133-238589155 TCGTGGGGGCGGGGGGTGGGTGG + Intergenic
948588953 2:239037463-239037485 GAGTGGGAGAGAGGGGTGGCTGG - Intergenic
948777325 2:240296568-240296590 TGCTGGGGGTGGGGGGTGGAGGG + Intergenic
948778731 2:240304082-240304104 TAGTGGGCGCTGAGGCTGGAGGG - Intergenic
1169178360 20:3539746-3539768 AAGTGGGAGGGGGCGGTGGAGGG - Intronic
1169489756 20:6061445-6061467 TGGTGGGGGGGGGGGGTGGGAGG + Intergenic
1169927597 20:10799142-10799164 TGTTGGGGGAGGGGGGTGGTGGG + Intergenic
1170562426 20:17569474-17569496 TAGTGGGGGAGGTGGGGGCAAGG - Intergenic
1170687160 20:18579832-18579854 GGGAGGGCAAGGGGGGTGGATGG + Intronic
1170848509 20:19982458-19982480 TGGTGGCTGAGGAGGGTGGAAGG - Intronic
1170989331 20:21287543-21287565 GTGTGGGCGGGGGGGGTGGGGGG + Intergenic
1171089137 20:22267674-22267696 TGGTGGGTGAGGGGCCTGGAGGG - Intergenic
1173288989 20:41697877-41697899 TAGTGGGCAAGGGAAGAGGAGGG - Intergenic
1173617322 20:44411528-44411550 GTGTGGGCGGGTGGGGTGGACGG + Intronic
1173719010 20:45237042-45237064 GAGTGGGGGTGGGGGGCGGATGG - Intergenic
1174560564 20:51428034-51428056 TAGTGGGTGAGAGGGAAGGAGGG + Intronic
1175325914 20:58128508-58128530 TAGGTGGGGAGGTGGGTGGATGG + Intergenic
1175429390 20:58891290-58891312 GCGGCGGCGAGGGGGGTGGAAGG - Intronic
1175847092 20:62064976-62064998 TGGCGGGCGCGGGGGGTGGCGGG + Exonic
1176172430 20:63702001-63702023 TAGTGGGTGACGGGGGGGGGGGG - Intronic
1178357569 21:31921445-31921467 GAGTGGGGGAAGGGGGTGGCTGG + Intronic
1178404208 21:32311402-32311424 TGGGGGGGGTGGGGGGTGGAGGG - Exonic
1178898987 21:36583969-36583991 GGGTGGGCGTGGGGGGTGGGTGG - Intergenic
1178898999 21:36583991-36584013 GGGTGGGCGTGGGGGGTGGGTGG - Intergenic
1179350975 21:40610585-40610607 TATTGGGGGAGGGGAGGGGATGG - Intronic
1180028056 21:45179924-45179946 GAGAGGGCAAGGGGGGTGGGAGG + Intronic
1180818432 22:18807971-18807993 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1181204654 22:21242426-21242448 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1181557346 22:23678768-23678790 CAGAGGGCGAGGTGGGTGAATGG + Intergenic
1181646825 22:24235888-24235910 GGGTGGGCGAGGTGGGTGCAGGG - Intronic
1181697037 22:24598790-24598812 GGGAGGGCGAGGTGGGTGGATGG - Intronic
1181852993 22:25763251-25763273 GAGGGGGCGAGGATGGTGGAGGG - Exonic
1182351947 22:29704345-29704367 TGGTGGGGGAGGGGAGGGGAGGG - Intergenic
1182351967 22:29704387-29704409 TGGTGGGGGAGGGGAGGGGAGGG - Intergenic
1183256912 22:36768322-36768344 TGTGGGGCGTGGGGGGTGGAAGG + Intronic
1184200067 22:42962560-42962582 AACTGGGGGTGGGGGGTGGAGGG + Intronic
1184410424 22:44323053-44323075 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184410547 22:44323571-44323593 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184798398 22:46745434-46745456 TAATGGCCGAGGCAGGTGGAAGG - Intergenic
1203222270 22_KI270731v1_random:52989-53011 AAGTGGGGGAGGGGGGCTGATGG - Intergenic
1203255435 22_KI270733v1_random:135399-135421 TGGTGGGGGTGGGGGGGGGAGGG + Intergenic
949491600 3:4594698-4594720 TGGTGGGGGTGGGAGGTGGAGGG - Intronic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
949863991 3:8532392-8532414 GAGTGGGTGAGGGTGGGGGATGG + Intronic
950719749 3:14874538-14874560 TAGTGGTTGCCGGGGGTGGAGGG + Intronic
950944353 3:16929184-16929206 TCGTGGGAGAGAGGGGAGGAGGG + Intronic
951016926 3:17742213-17742235 GAGTCGGCGTCGGGGGTGGATGG - Intronic
952236128 3:31482050-31482072 TTTTGGGCGGGGGGGGTGGGGGG - Intergenic
952621000 3:35342389-35342411 AAGTGGGGGAGGGGGGAAGAAGG + Intergenic
953030628 3:39177698-39177720 TAGCGGGGGCGGGGGGGGGAGGG + Intergenic
953280383 3:41548658-41548680 TAGTGGGCAGGGAGGGTGGGTGG - Intronic
953407164 3:42665173-42665195 GGGTGAGCGTGGGGGGTGGAGGG + Exonic
953663169 3:44905771-44905793 TAGGGGGTGAGGGTGGTGGGAGG + Intronic
953903939 3:46858792-46858814 TCTTGGGAGAGGGTGGTGGAGGG + Intronic
954579698 3:51696601-51696623 TAGTGGGGGCTGGGGATGGAAGG - Intronic
955175701 3:56611563-56611585 AACTGGGCGTGGGGGGTGGGGGG - Intronic
955227658 3:57074339-57074361 TGGTGGGGGTGGGGGATGGAAGG - Exonic
956061619 3:65353745-65353767 AAGTGGGGGAGGGGGGCGGCGGG + Intronic
956717717 3:72092857-72092879 TTGGGGGCGAGGGAGGTGGGAGG + Intergenic
958668651 3:97174018-97174040 TAGTGGGGGACTGGGGGGGAAGG - Intronic
959830691 3:110858201-110858223 AAGTGGGAGAGAGGGGTGCAGGG + Intergenic
959849409 3:111070665-111070687 TACTGTGCGAGGCGGGAGGATGG + Intronic
960646772 3:119893727-119893749 TAGGGGGCAATCGGGGTGGATGG + Intronic
961335597 3:126177550-126177572 TAGGGGGGTTGGGGGGTGGATGG + Intronic
961384540 3:126516386-126516408 TGGTGGGCGCTGGGGGTGGGAGG - Intronic
961662974 3:128480190-128480212 TAGGAGGCGAGGGGGTTGAAGGG + Exonic
962610228 3:137069540-137069562 TAGGGGTTGAGGGGGGTGGTTGG + Intergenic
962809331 3:138947544-138947566 GAGACGGCGAGGGGGCTGGACGG + Intronic
962951357 3:140222322-140222344 TAGTGAGGGATGGGGGTGGAAGG + Intronic
964509611 3:157436724-157436746 TGGTGGGGGAGGGGGCTGGGTGG - Intronic
965896008 3:173576789-173576811 TGGCGGGGGAGGGTGGTGGAGGG + Intronic
966172241 3:177095206-177095228 TAGGGGGAGAGGGGGGTGTTGGG + Intronic
966705236 3:182906557-182906579 TACTGGGGGAGAGGGGTCGAGGG - Intronic
967127405 3:186436193-186436215 AAGAGGGAGAGGGAGGTGGAGGG + Intergenic
967478628 3:189949336-189949358 GAGTGGGGGAGGGGAGGGGAGGG - Intergenic
968072627 3:195795837-195795859 AAGTGGGGGAGGGGGGTGGGAGG + Intronic
968086940 3:195878038-195878060 CAGTGGGAAAGGGTGGTGGAGGG + Intronic
968117409 3:196099969-196099991 TGCTGGGCGTTGGGGGTGGAAGG + Intergenic
968746909 4:2365022-2365044 AAGTGGGGGAGGGAGGTGGAGGG + Intronic
968912422 4:3483051-3483073 TAGGTGGCCAGGGGTGTGGAGGG + Intronic
968961393 4:3746022-3746044 GAGTGGGGGAGGGGCGGGGAGGG + Intergenic
969357705 4:6640297-6640319 TGGGAGGCGAGGTGGGTGGATGG - Exonic
969677364 4:8621463-8621485 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969678319 4:8627101-8627123 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969679275 4:8632739-8632761 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969939979 4:10722367-10722389 TAGCGGGAGATGGGGCTGGAAGG - Intergenic
972383907 4:38545144-38545166 TAGTGGGAGAGTGGGGTAGGGGG - Intergenic
972543507 4:40058923-40058945 TAGGGGACGAGGTGGGAGGATGG - Intronic
973725514 4:53771782-53771804 TGGTGGGCCTGGGGGGTGGGAGG + Intronic
973752168 4:54032273-54032295 TAGAGGGAGAGGGAGGGGGAGGG - Intronic
973818848 4:54644646-54644668 TAGTGGGGGAGGTGGGAGGCTGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
975716024 4:77206462-77206484 TACTTGGGGTGGGGGGTGGAAGG + Intronic
975763992 4:77648024-77648046 TAGGGGGCTAGGGGGGAGGTGGG + Intergenic
976723942 4:88197370-88197392 TATTGGGAGAGTGAGGTGGAAGG + Intronic
977231274 4:94453037-94453059 TAGTGGGTGAGAGGGGAGAAAGG - Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
979611860 4:122697806-122697828 TAGAGGGCCAGGGTGGTGGATGG - Intergenic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
982467404 4:155747965-155747987 TTGTGGGCGGGGGGGGGGGGGGG - Intergenic
983217182 4:165012931-165012953 TAGTGGTTGACGGGGTTGGAGGG + Intergenic
983827649 4:172284388-172284410 TGGTGTGTGTGGGGGGTGGATGG - Intronic
983941082 4:173534748-173534770 GAGGGAGGGAGGGGGGTGGAAGG - Intergenic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985452968 4:190070931-190070953 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985453957 4:190074224-190074246 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985454945 4:190077517-190077539 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985455931 4:190080814-190080836 TGGTGGGGGGGGGGGGTGGGGGG - Intergenic
985456916 4:190084108-190084130 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985457904 4:190087404-190087426 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985458892 4:190090701-190090723 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985476210 5:80694-80716 TAGTGGGCAAAGGTGGTGGGAGG - Intergenic
985627221 5:995348-995370 GAGGGGGCGATGAGGGTGGATGG - Intergenic
985701520 5:1376078-1376100 GTGTGGGAGAAGGGGGTGGAAGG - Intergenic
985749706 5:1667283-1667305 GAGGGGGGGAGGGGGGAGGAGGG - Intergenic
986076680 5:4345016-4345038 TCTTGGGCAATGGGGGTGGAGGG + Intergenic
986835434 5:11631833-11631855 AAGTGGGCGATGGGGCTGGATGG - Intronic
988612172 5:32737103-32737125 TAGGAGGGGAGGAGGGTGGAAGG - Intronic
988846659 5:35134402-35134424 GAGTGGGGGAGGGGGTTGGTGGG + Intronic
988999258 5:36744152-36744174 TTGTGGGAGAGGGAGATGGAAGG - Intergenic
989664049 5:43832024-43832046 AAGTGGGGTAGGTGGGTGGATGG - Intergenic
990051498 5:51507083-51507105 TTGTGGGGAAGGGGGTTGGAGGG - Intergenic
990301970 5:54458456-54458478 TAGTGGGCAAGAGGGGAGAATGG + Intergenic
990347395 5:54883974-54883996 GGGTGGGCGAGCGGGGAGGAGGG - Intergenic
990484761 5:56247240-56247262 TAGTGGGCTAGAGGGATGGGAGG - Intergenic
991189531 5:63853271-63853293 AAGTGGGCGGGTGGGGAGGAGGG + Intergenic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992081181 5:73235045-73235067 TATTGGGCGAGGGGTGGGGTGGG - Intergenic
993890552 5:93466903-93466925 TTGGGGGGGGGGGGGGTGGACGG + Intergenic
996124415 5:119707988-119708010 TGGTGGACCAGGTGGGTGGACGG + Intergenic
996744712 5:126836889-126836911 GGGTGGGGGAGGGAGGTGGAGGG + Exonic
998131938 5:139655742-139655764 TGGTGGGGGAGGGGGCAGGAAGG - Intronic
998261583 5:140635761-140635783 TGTTGGGGGAGAGGGGTGGAGGG + Intergenic
998662025 5:144249417-144249439 TTGTGGGAGAGGGGAGGGGAAGG - Intronic
1000189923 5:158900286-158900308 CGGTGGGAGAGGGGAGTGGAGGG + Intronic
1000632010 5:163601426-163601448 TGGTTGGCTAGGGGGCTGGAGGG + Intergenic
1000930612 5:167246765-167246787 TGGTTGGCGCGGGGTGTGGATGG + Intergenic
1001172618 5:169434892-169434914 TAGTTGACGGGGGGGGTGGGAGG + Intergenic
1001424683 5:171615564-171615586 TATTGGTGGTGGGGGGTGGAGGG - Intergenic
1001438291 5:171718164-171718186 AGGTGGGGGAGGGGTGTGGAGGG - Intergenic
1001523087 5:172409140-172409162 GAGAGGCCGAGGTGGGTGGATGG + Intronic
1001579819 5:172790952-172790974 CAGTGGGGGTGGGGGATGGAGGG - Intergenic
1001644371 5:173269254-173269276 TTGGGGGCGGGAGGGGTGGAGGG + Intergenic
1001692130 5:173641153-173641175 TGGTGGGCGTGGGGGCTAGATGG + Intergenic
1002466948 5:179412670-179412692 TGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1003278756 6:4674341-4674363 CAGTGGGCGGGGGGGGGGGGGGG + Intergenic
1003469733 6:6418051-6418073 TAGTGGGAGTGGTGGGTGGAGGG - Intergenic
1003552193 6:7109017-7109039 TCGCGGGCGGGGGGGGTGGGGGG + Intronic
1005191379 6:23228210-23228232 TTGTGGGGGCGGGGGGTGGCGGG + Intergenic
1006437867 6:34035640-34035662 TGGTGGGGGCCGGGGGTGGACGG - Intronic
1006510580 6:34519097-34519119 GAGTGGGCTAGGGAGGAGGAGGG + Intronic
1007049850 6:38816229-38816251 TGGTGGGGGATGGGGGTGAAGGG - Intronic
1007408110 6:41646317-41646339 TAGGGGGCCAGGAGGTTGGATGG + Intronic
1008058187 6:46967102-46967124 CAGTGGGCGGGGGGGGGGGGGGG + Intergenic
1011042515 6:83046665-83046687 CAGTTGGCGGGGGGGGTGGGCGG + Intronic
1011406729 6:87022932-87022954 AAGTGGGGGAGGGAGGGGGAGGG + Intergenic
1011632383 6:89339638-89339660 GAGTGGGGGAGGGGAGGGGAGGG + Intronic
1011637188 6:89385480-89385502 TAGTGCTCAAGGGGAGTGGATGG - Intronic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1013251613 6:108340032-108340054 TAGTGGGAGGCTGGGGTGGAGGG - Intronic
1014935479 6:127380473-127380495 TAGTGGGTGGGAGGGGTGGGCGG - Intergenic
1015282006 6:131443743-131443765 GAGTGGCCGAGCGGGGTAGAGGG - Intergenic
1015749547 6:136546355-136546377 TAGTGGGGGTAGGGGGTGGGAGG - Intronic
1016376864 6:143430224-143430246 GAGTGTGCGAGTGGAGTGGAGGG - Intronic
1016480065 6:144471068-144471090 GAGGGGGCGAGGGAGGGGGAGGG + Intronic
1016900668 6:149097542-149097564 TAGTGGGCTAGGTGTGTGGGTGG - Intergenic
1017637303 6:156456075-156456097 GAGTGGAGGAGGGGGGAGGAGGG - Intergenic
1017689420 6:156948409-156948431 CAGTGGGTGGTGGGGGTGGAGGG + Intronic
1017706818 6:157131463-157131485 TCGTGGGCGAGCCGGGAGGAGGG + Intronic
1018654671 6:166024161-166024183 TAGGGGGAGAGGGAGGCGGATGG + Intergenic
1019587932 7:1814953-1814975 TGGTGGGCGGGGGGGGGGGGGGG + Intergenic
1020260911 7:6530511-6530533 GGGAGGGCGAGGGGGGTGGGGGG - Intronic
1021717343 7:23471404-23471426 TGGTGGGGGAGGGGAGTGCAGGG + Intergenic
1024119837 7:46225548-46225570 TAGTGGGCTGAGGGGCTGGAAGG + Intergenic
1024159891 7:46663427-46663449 GAGTGGGGAAGGGGAGTGGAAGG - Intergenic
1024985643 7:55191352-55191374 AAGTGGGGGTGGGGGGTGGCGGG - Intronic
1025609611 7:63066863-63066885 TAGTGAGGGATGGGGGAGGAAGG + Intergenic
1027252157 7:76405779-76405801 TGGTGGGAGAGGGGGTTGGCAGG + Intronic
1027455839 7:78390633-78390655 TGGTGGGGGTGGGGGGTGGAGGG + Intronic
1028051649 7:86195367-86195389 AAGAGGGCGAGGGGTGTGGGTGG - Intergenic
1028520183 7:91721247-91721269 TAGTGGGCCAGGCAGGTGGGTGG - Intronic
1029459770 7:100687952-100687974 GCGTGGGCGAGGGGGGTTGGCGG - Intronic
1031992141 7:128205423-128205445 TGGCAGGGGAGGGGGGTGGAGGG + Intergenic
1032708536 7:134442942-134442964 TAGTGGTAGAGGGGTCTGGAGGG - Intronic
1032916449 7:136495407-136495429 TAGTGGGGGGGGGGGGGGGGTGG - Intergenic
1033168000 7:139058150-139058172 TAGTGGGGGAGGGTGGGGGGTGG - Intronic
1033303338 7:140205833-140205855 TAGTGGGGGAGGGTCGGGGATGG + Intergenic
1034285022 7:149878796-149878818 GTGTGGGCGAGGGGTGTGGGTGG + Intronic
1034412341 7:150947927-150947949 GAGGGGGCGAGGGTGGAGGAGGG + Intronic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035401776 7:158570416-158570438 TGGTGGGAGAGGGTGCTGGAGGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036258959 8:7225817-7225839 AGGTGGGGGAGGGGGGAGGATGG - Intergenic
1036311012 8:7684413-7684435 AGGTGGGGGAGGGGGGAGGATGG - Intergenic
1036584076 8:10106882-10106904 TAGAGGGGTAGGCGGGTGGAGGG - Intronic
1036780629 8:11644587-11644609 TAGTGGGCAGGTGGGGTGGGAGG - Intergenic
1037104006 8:15082478-15082500 AAATGGGGGAGGGTGGTGGAGGG + Intronic
1037261962 8:17019630-17019652 TGGTGGGCGTGGGGTGGGGAGGG - Intergenic
1037988669 8:23305501-23305523 TGGTGGGCGGGGGGTGTGGGGGG - Intronic
1039755112 8:40514368-40514390 TTGTGGGGGAGGGGTGGGGAGGG + Intergenic
1039884354 8:41646866-41646888 TGGTGGGGGCGGGGGGCGGAGGG - Intronic
1040102338 8:43516717-43516739 TGGTGGGTGAGGGTGGAGGATGG + Intergenic
1042170355 8:65985300-65985322 TGGTGGGGGTGGGGGGTGGGAGG + Intergenic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042851290 8:73218688-73218710 TATTGGGGGAGGGTGGGGGAAGG - Intergenic
1043972947 8:86552964-86552986 TTGTGGGCGGGGGGGGGGGGGGG - Intronic
1044419108 8:91971021-91971043 TAGTGGGCATGGTGGCTGGAAGG - Intronic
1044849928 8:96418163-96418185 TAATGGGGGTAGGGGGTGGAGGG + Intergenic
1047451816 8:124972048-124972070 TATTTGGGGATGGGGGTGGAGGG + Intergenic
1047759053 8:127940590-127940612 TTGTGGGGGGGGGCGGTGGAGGG + Intergenic
1048457782 8:134593346-134593368 TACTGGGCGGGGGTGGTGGGGGG + Intronic
1049167073 8:141133120-141133142 CAGTGAGCGTGGGGGGTGGAGGG + Intronic
1049322809 8:142006040-142006062 TTGTTGGGGAGGGGGGTGCAGGG - Intergenic
1049368847 8:142253866-142253888 CAGTGGGTGAGGGAGGTGGGAGG + Intronic
1049836975 8:144742471-144742493 TAGTGGGGGAGGTGTGTGGGGGG - Intronic
1050160248 9:2711379-2711401 TGGTGGGGGGGGGGGGTGGGGGG + Intergenic
1051387544 9:16525067-16525089 GAGTGGGGGAGGGGGGGGGAAGG + Intronic
1051491565 9:17672631-17672653 TATTGGGTGAAGGGGGTGGGTGG - Intronic
1051706165 9:19882494-19882516 AAGTGGGTGGGGGGCGTGGAGGG - Intergenic
1051769131 9:20557259-20557281 TAGTGGGGTAGTGGGGTTGAGGG + Intronic
1054374951 9:64442448-64442470 CAGTGGGAGATGGGGGTGGGAGG + Intergenic
1054521791 9:66080060-66080082 CAGTGGGAGATGGGGGTGGGAGG - Intergenic
1054906751 9:70419599-70419621 TCGCGGGCGTGGGGGATGGAAGG - Intergenic
1055637164 9:78290223-78290245 TATTGGGCGAGGGGCCTGGTGGG - Intergenic
1055963103 9:81839456-81839478 TTGGGGGGGGGGGGGGTGGATGG + Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056562944 9:87748546-87748568 TCTGGGGCAAGGGGGGTGGAAGG - Intergenic
1057172562 9:92971948-92971970 GTGTGGGGGAGGGGGGTGGATGG - Intronic
1057630662 9:96716507-96716529 AAGTGGGAGAGGGAGGGGGACGG + Intergenic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1058688035 9:107495039-107495061 GAGAGGTCGAGGTGGGTGGATGG - Intergenic
1058866523 9:109166803-109166825 GAGGGGGCGAGGGAGGGGGAGGG - Intronic
1058884387 9:109312507-109312529 AGCTGGGCGAGGGGGGTGGGAGG - Intronic
1059145191 9:111893713-111893735 TAGTGGAGGAGGCTGGTGGAGGG - Intergenic
1059394352 9:114024728-114024750 TAATGGGGGATGGGGGTGGGGGG - Intronic
1059768538 9:117406475-117406497 TGGTGGAGGAGGGGGGTGGCAGG - Intronic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060446883 9:123697683-123697705 AAGTGGGGGAAGGGGGAGGAAGG - Intronic
1060788025 9:126465665-126465687 TGGTGGGGGCGGGGGGTGGGGGG + Intronic
1060859084 9:126939074-126939096 AAGTGGGAGAGGGGGGCAGAGGG + Intronic
1061246002 9:129401569-129401591 TAGTGGGGCAAGGGGGTGGGAGG + Intergenic
1061284281 9:129613367-129613389 CTGTAGGCAAGGGGGGTGGAGGG + Intronic
1061416715 9:130451119-130451141 ATGTGGGGGAGGGGGGTGCAGGG + Intronic
1061491006 9:130944406-130944428 TAGAGGGCTGGAGGGGTGGAGGG + Intergenic
1203624602 Un_KI270750v1:1394-1416 AAGAGGGAGAGGTGGGTGGAGGG + Intergenic
1185511663 X:668310-668332 AAGTGGGGGAGGGGAGGGGAGGG - Intergenic
1185603676 X:1355195-1355217 TGGAGGGGGAGGAGGGTGGAGGG + Intronic
1185603684 X:1355211-1355233 TGGAGGGGGAGGAGGGTGGAGGG + Intronic
1186420310 X:9420329-9420351 TGGTGGGAGAGGGGGATGAAGGG - Intergenic
1186523632 X:10228222-10228244 GAATGGGGGAGGGGGGAGGAGGG - Intronic
1186638957 X:11434656-11434678 TAGTTGGCGGGGGGAGGGGAGGG - Intronic
1187928918 X:24276092-24276114 TATTGGGAGAGGGGCCTGGAGGG + Intergenic
1189365246 X:40383210-40383232 TGGTGGGGGTGGGGGGTGGGCGG + Intergenic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1189800568 X:44688481-44688503 TGGTGGGGGTGGGGGGTGGCGGG + Intergenic
1193085783 X:77447212-77447234 TTTTGGGAGAGGGGGGTGGAGGG - Intergenic
1193378820 X:80794264-80794286 TAGAGGCCGAGGCAGGTGGATGG + Intronic
1193445524 X:81597087-81597109 TAGTGGGAGAGCAGGTTGGAAGG + Intergenic
1193846142 X:86473503-86473525 TAGTGGGTGATGGGGGAGGAAGG - Intronic
1194348505 X:92796016-92796038 GAGAGGGCGAGGGAGGGGGAAGG + Intergenic
1197581695 X:128291924-128291946 TAGGGGGAGAGGGGTGGGGATGG + Intergenic
1197770405 X:130085811-130085833 TTGTGGGGGAGGGGTGTTGAGGG - Intronic
1197986716 X:132273840-132273862 TAATGGGTATGGGGGGTGGATGG - Intergenic
1199350174 X:146790817-146790839 TTGTGGGCTGGGTGGGTGGAAGG - Intergenic
1200280199 X:154770697-154770719 TGGTGTGGGAGTGGGGTGGAGGG + Intronic
1200826471 Y:7649989-7650011 TAGTGGGAGTGGGGGTGGGAGGG + Intergenic
1201699496 Y:16864756-16864778 GGGTGGGGGAGGGGGGAGGAGGG + Intergenic
1202233428 Y:22679866-22679888 TAGTGGGAGTGGGGGTGGGAGGG - Intergenic
1202309728 Y:23516292-23516314 TAGTGGGAGTGGGGGTGGGAGGG + Intergenic
1202561073 Y:26154301-26154323 TAGTGGGAGTGGGGGTGGGAGGG - Intergenic