ID: 1116462893

View in Genome Browser
Species Human (GRCh38)
Location 14:45198052-45198074
Sequence CAAATTAAAAAGAAGGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 538}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116462893_1116462901 21 Left 1116462893 14:45198052-45198074 CCACCAGCCTTCTTTTTAATTTG 0: 1
1: 0
2: 6
3: 62
4: 538
Right 1116462901 14:45198096-45198118 TAGATTTGGAATAGACAGGAAGG 0: 1
1: 0
2: 0
3: 21
4: 203
1116462893_1116462902 29 Left 1116462893 14:45198052-45198074 CCACCAGCCTTCTTTTTAATTTG 0: 1
1: 0
2: 6
3: 62
4: 538
Right 1116462902 14:45198104-45198126 GAATAGACAGGAAGGTAACATGG 0: 1
1: 0
2: 1
3: 22
4: 439
1116462893_1116462900 17 Left 1116462893 14:45198052-45198074 CCACCAGCCTTCTTTTTAATTTG 0: 1
1: 0
2: 6
3: 62
4: 538
Right 1116462900 14:45198092-45198114 GAAATAGATTTGGAATAGACAGG 0: 1
1: 0
2: 1
3: 20
4: 255
1116462893_1116462899 7 Left 1116462893 14:45198052-45198074 CCACCAGCCTTCTTTTTAATTTG 0: 1
1: 0
2: 6
3: 62
4: 538
Right 1116462899 14:45198082-45198104 AGGGATAAAGGAAATAGATTTGG 0: 1
1: 0
2: 5
3: 37
4: 491
1116462893_1116462898 -5 Left 1116462893 14:45198052-45198074 CCACCAGCCTTCTTTTTAATTTG 0: 1
1: 0
2: 6
3: 62
4: 538
Right 1116462898 14:45198070-45198092 ATTTGAAAAGTCAGGGATAAAGG 0: 1
1: 0
2: 1
3: 23
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116462893 Original CRISPR CAAATTAAAAAGAAGGCTGG TGG (reversed) Intronic
900378149 1:2369056-2369078 CAAAAAAAAAAAAAGGCGGGGGG + Intronic
900730072 1:4252347-4252369 AAAATTCAAAAGATGGCTGATGG - Intergenic
901717897 1:11171445-11171467 AAAATTTAAAAATAGGCTGGAGG - Intronic
901819451 1:11817718-11817740 CAAATTAAGTAGGAGGCTTGTGG - Intronic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
903524448 1:23982473-23982495 AAAATTAAAAACAAGGCCGGGGG - Intergenic
903953299 1:27008966-27008988 AAAAAAAAAAAGAAGGATGGAGG - Intronic
903996116 1:27306474-27306496 GAAATGAAAAAAAAGGGTGGTGG - Exonic
904336463 1:29801372-29801394 TAAATTAAACACAATGCTGGAGG - Intergenic
904653519 1:32024968-32024990 CAAACAAAAAAAAAGGCGGGGGG + Intronic
906077241 1:43060984-43061006 CAAAAAAAAAAAAGGGCTGGGGG + Intergenic
906547140 1:46627815-46627837 CAAAAAAAAAAAAAGGGTGGGGG - Intergenic
906984099 1:50664495-50664517 ACAACTAAACAGAAGGCTGGGGG + Intronic
907105587 1:51879401-51879423 CGAATTTAACAGGAGGCTGGAGG - Intergenic
907115261 1:51962509-51962531 CAAATTATAAAGCAGACAGGTGG - Intronic
907170561 1:52459590-52459612 AAAATAAAAATAAAGGCTGGGGG + Intronic
907350804 1:53829191-53829213 CAAAGTAAAGAGATGGCAGGAGG + Intronic
907690375 1:56658728-56658750 GAAAAAAAAAAGAAGGCAGGAGG - Intronic
908005197 1:59720556-59720578 CAAAGTGAAATGAAGGCTTGAGG - Intronic
908013575 1:59808767-59808789 CAATTCACAAAGAAGGCTGATGG - Intergenic
908227861 1:62074195-62074217 CAAATTAAAAAAAATAGTGGGGG + Intronic
908242847 1:62202300-62202322 CAAAAAAAAAAAAAGGCTGAGGG + Intronic
908541601 1:65127730-65127752 CAAATAAATAGGAAGGGTGGAGG + Intergenic
908676961 1:66615431-66615453 CAATTTAAAAAGGAAGCTGGTGG - Intronic
909645786 1:77915327-77915349 ATAAATAAAAAGAAAGCTGGTGG + Intronic
909723651 1:78808316-78808338 TAAATGAAAAAGAAGGAAGGTGG + Intergenic
911268917 1:95776818-95776840 CAAATTAAAAAGTAGCCTTTGGG + Intergenic
912396077 1:109344988-109345010 AAAATAAATATGAAGGCTGGGGG - Intronic
912750531 1:112283564-112283586 AAAAAAAAAAAAAAGGCTGGAGG + Intergenic
912922581 1:113883481-113883503 CAAAAAAAAAAAAAGGCGGGCGG + Intronic
913275788 1:117136690-117136712 CAAAGAAAAAAAAAGGGTGGGGG + Intergenic
913378893 1:118186467-118186489 CAAATGAAAAAGGATGCTAGTGG - Intergenic
913709630 1:121469711-121469733 CAAATTAAAGAGAAGGCTATGGG - Intergenic
913713970 1:121515245-121515267 AAAAAAAAAAAAAAGGCTGGAGG + Intergenic
915242597 1:154534021-154534043 CCATTTAAAAATACGGCTGGGGG - Intronic
915406984 1:155667528-155667550 TAAATAAAAAAGAAGGCTGGGGG + Intronic
915573692 1:156760835-156760857 GAAAAAAAAAAAAAGGCTGGGGG - Intronic
917021449 1:170592947-170592969 GAAAATAAAAGGGAGGCTGGAGG + Intergenic
917098486 1:171423240-171423262 AAAATAAAAAATAAGGCAGGAGG + Intergenic
917237416 1:172909364-172909386 CATACTAAAAAAAAGGTTGGTGG + Intergenic
917337150 1:173936529-173936551 AAAAAAAAAAAGAAGGTTGGAGG + Exonic
917947953 1:179995888-179995910 CAAATTAATAAATAGACTGGGGG - Intronic
918119083 1:181521890-181521912 AGAAACAAAAAGAAGGCTGGAGG + Intronic
918394908 1:184103578-184103600 CAATTAAAAAAGAAAGCTTGTGG - Intergenic
918471278 1:184877356-184877378 CAAAGGAAAAAGAAGGCTATAGG + Intronic
918966304 1:191353817-191353839 CTAAGCAAAAAGAAAGCTGGAGG - Intergenic
919698115 1:200600573-200600595 CAAATGAAATAGAAGATTGGAGG - Intronic
920286739 1:204885108-204885130 CATATTAAAAAAAAAGATGGGGG - Intronic
920384478 1:205559788-205559810 AAAAAAAAAAAGAAAGCTGGAGG + Intergenic
920619009 1:207525591-207525613 CAAATTAAAAAGCAGGATGATGG - Intronic
920620790 1:207544147-207544169 CAAATTAAAAAGCAGGATGATGG - Intronic
920622572 1:207562704-207562726 CAAATTAAAAAGCAGGATGATGG - Intronic
920635297 1:207696344-207696366 CAAATTAAAAAGCAGGATGATGG - Intronic
920827190 1:209433291-209433313 CCAATTATAAAAAAGGCTTGTGG - Intergenic
921852316 1:219944148-219944170 AAAATTAAAAAAAAAACTGGCGG + Intronic
921922410 1:220684488-220684510 CAACTTAAAAGGAAGGTGGGGGG - Intergenic
922537493 1:226391835-226391857 TTGATTAAACAGAAGGCTGGAGG + Intronic
923146853 1:231204141-231204163 AAAAGGATAAAGAAGGCTGGCGG + Intronic
923558036 1:235016891-235016913 TAAATTAAAAAGAAGGCAAGAGG + Intergenic
923943784 1:238859695-238859717 AAAAGAAAAGAGAAGGCTGGAGG + Intergenic
924064062 1:240206202-240206224 CAATTTATAAAGACGGCTGATGG - Intronic
924611209 1:245575179-245575201 CAAAGAAAAAGGTAGGCTGGGGG + Intronic
1062891079 10:1060490-1060512 CATATTACAAAGAAGGCTTATGG - Intronic
1062984895 10:1759592-1759614 AAAATTAAGTACAAGGCTGGAGG + Intergenic
1063243362 10:4193713-4193735 CATATGAAAAAGAATGTTGGGGG - Intergenic
1063823585 10:9867026-9867048 CAAAAAAAAAACAAAGCTGGAGG - Intergenic
1064042178 10:11976678-11976700 CCCATTAAAAAGGAGGCTGAAGG + Intronic
1064862473 10:19842717-19842739 CAAATTTAGAAGAAGGATGTAGG + Intronic
1064909809 10:20387601-20387623 CTAATAGAAAATAAGGCTGGTGG + Intergenic
1065555099 10:26907154-26907176 TAAATTACAATGATGGCTGGGGG - Intergenic
1065656022 10:27950751-27950773 CAAATTAAAAAGAATGCATATGG - Intronic
1066473356 10:35720754-35720776 CAAATTAAATGGAAGGTTGAAGG + Intergenic
1069513728 10:69060980-69061002 TGTATTAAAAAGAGGGCTGGAGG - Intergenic
1070218139 10:74408284-74408306 CAAATTCAAATTCAGGCTGGGGG - Intronic
1070245303 10:74725542-74725564 CTATTTTAAAAGAAGGCTGTGGG + Intergenic
1070568211 10:77619953-77619975 CAAATGTGATAGAAGGCTGGGGG - Intronic
1071322120 10:84472574-84472596 AAAATAAAATAGAAGACTGGGGG + Intronic
1071557956 10:86620614-86620636 AAAAAAAAAAAGAATGCTGGAGG - Intergenic
1071770772 10:88727042-88727064 CAAATTAAACAGAGAGATGGGGG - Intronic
1073357876 10:102871251-102871273 CAAAACAAAAAAAAGGCCGGGGG + Intronic
1074905881 10:117863206-117863228 GAAAATAAAATGAAAGCTGGAGG - Intergenic
1075305002 10:121359962-121359984 CAAACTAACAAGAAGCCTGCAGG + Intergenic
1075437216 10:122453800-122453822 GAAAAAAAAAAAAAGGCTGGGGG + Intergenic
1075527072 10:123195841-123195863 GAAAGTAAAATAAAGGCTGGGGG - Intergenic
1075992902 10:126853170-126853192 AAAATAAAATAGAAGGCTGGAGG - Intergenic
1076303234 10:129443831-129443853 TTAATTAAAAAGTAAGCTGGTGG + Intergenic
1077981074 11:7301390-7301412 CATATTAAAAAGCAGGTGGGTGG + Intronic
1078142320 11:8701428-8701450 CAGTTTGATAAGAAGGCTGGAGG - Intronic
1078297388 11:10087234-10087256 CAGATTGAAAAGCAGCCTGGAGG - Intronic
1078385255 11:10885310-10885332 CAACATAAAAAGTAGGCTGGGGG - Intergenic
1078976219 11:16480650-16480672 CATAATAAAAAGAAGGTGGGGGG - Intronic
1079389656 11:20010502-20010524 CAAATTAAAAAAAAGGTGGTGGG - Intronic
1080284941 11:30599800-30599822 CAATTTAATAAAAAGACTGGGGG - Intergenic
1080322192 11:31023305-31023327 CCAATTAAAACAAAGGCTTGAGG + Intronic
1080353599 11:31414785-31414807 CCAATCAAAAAGAAGGGTGCAGG - Intronic
1081472540 11:43389138-43389160 CAAAAAAAAAAAAAGGGTGGAGG + Intronic
1082920955 11:58493266-58493288 AAAAAGAAAAAGGAGGCTGGGGG + Intergenic
1084598178 11:70129620-70129642 CAAAAAAAAAAAAAGGCGGGGGG - Intronic
1084637525 11:70401841-70401863 AAAAAGAAAAAAAAGGCTGGTGG + Intronic
1085072975 11:73564752-73564774 AAAAAAAAAAAGAAGGCTAGAGG + Intronic
1085089039 11:73693917-73693939 AAAGTTAAAAATAAGGATGGGGG - Intronic
1085374394 11:76045660-76045682 AAAATTCAACAGAATGCTGGAGG + Intronic
1086185201 11:84005070-84005092 CAAACAAAAAACAAAGCTGGAGG + Intronic
1086762444 11:90649468-90649490 AAAAAAAAAAAGAAAGCTGGAGG + Intergenic
1086951634 11:92896796-92896818 AAAATTGAAAAGAGTGCTGGAGG + Intergenic
1087333011 11:96806649-96806671 CAAAAAAAAAACAAAGCTGGAGG + Intergenic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1087977984 11:104574124-104574146 TAAATAAAAAACAAAGCTGGAGG + Intergenic
1088296786 11:108306815-108306837 CATTTAAAAAAGTAGGCTGGGGG - Intronic
1088299776 11:108344701-108344723 CTGATTAAAAATAAGGTTGGGGG + Intronic
1088477805 11:110261801-110261823 CTATTTAAAAAGAAGGAAGGTGG - Intronic
1089289458 11:117428885-117428907 CAAATCAGAGAGAAGACTGGGGG - Intronic
1089857764 11:121561694-121561716 AAAAAAAAAAAAAAGGCTGGGGG + Intronic
1090022715 11:123141977-123141999 AAAAAAAAAAAAAAGGCTGGGGG - Intronic
1091142363 11:133246130-133246152 AAAATTAAAAAGAAGCTTGGTGG + Intronic
1091422988 12:359741-359763 CAAAAAAAAAAAAAGGGTGGGGG + Intronic
1091533579 12:1384529-1384551 AAAATTAAAAAAAATGCTGGTGG - Intronic
1092246139 12:6865425-6865447 CTATTTAAAAAAAAAGCTGGTGG - Intronic
1093152765 12:15642966-15642988 CACATTAAAAAGAAAATTGGTGG + Intronic
1093659817 12:21742902-21742924 CAGATTAAAAAAAAAGCTGAAGG - Intronic
1095275932 12:40282217-40282239 AAAATTAAAAGGAAGGCAGGTGG - Intronic
1095365545 12:41399938-41399960 CACAGTAAAAAGGGGGCTGGGGG + Intronic
1095770095 12:45944804-45944826 CAAATTAGAAGTAAGGCTAGAGG + Intronic
1095996049 12:48085490-48085512 CAAAATGTAAAGAAGGCTGATGG - Intronic
1096541323 12:52308843-52308865 CAAAAAAAACAGAAGGCAGGCGG - Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096833501 12:54332749-54332771 AAAAAAAAAAAGAAAGCTGGAGG + Intronic
1097016841 12:55993242-55993264 TGAATTAAAAAGAAGGTGGGAGG - Exonic
1097550146 12:61057715-61057737 AAAATAAAAAAGATGGCTGTAGG + Intergenic
1097605990 12:61755075-61755097 CTAATTAAAAAGAAGGGTGGGGG - Intronic
1097734707 12:63168954-63168976 CAAAATAAAAAGAATGATAGAGG - Intergenic
1098262157 12:68682655-68682677 CAAAATAAAAAGTAGGGAGGGGG + Intergenic
1098353675 12:69589271-69589293 CAAAAAAAAAAGAGGGGTGGGGG - Intronic
1098456178 12:70676852-70676874 CAAAAAAAAAAAAAAGCTGGAGG - Intronic
1098537405 12:71608950-71608972 TTAATCAAAAAGAAAGCTGGAGG - Intergenic
1098784200 12:74728980-74729002 TTAATTAAAAATAAGGCAGGAGG - Intergenic
1098928861 12:76385904-76385926 AAAATTAAAAAAAGGGCAGGGGG + Intronic
1098971669 12:76863593-76863615 CAAACTAAAAATAAAGCTTGAGG - Intronic
1099413192 12:82357819-82357841 CAAATTAAAGCGAAGGCTGGAGG + Intronic
1099589019 12:84562229-84562251 TAAATTAACAAGAATGCTGGAGG + Intergenic
1099763555 12:86952163-86952185 AAAATTAATAAGAAGGCAGGTGG + Intergenic
1100266661 12:92983436-92983458 CAAAAAAAAAACAAAGCTGGAGG + Intergenic
1101228408 12:102713302-102713324 CAAATTACAAAATAGACTGGTGG + Intergenic
1103690570 12:122770641-122770663 CAAATTGGAAAGAAGACTTGTGG + Exonic
1103722826 12:122983732-122983754 GAAATCAAAGAGAAGGCAGGTGG + Exonic
1104403869 12:128501275-128501297 CAATCTAGAATGAAGGCTGGTGG + Intronic
1104437439 12:128767090-128767112 TTAATTAGAAAGAAAGCTGGGGG + Intergenic
1104552328 12:129768745-129768767 TAACTTAACAAGAAGTCTGGAGG - Intronic
1106083959 13:26523853-26523875 CACATTAGGAAGAAGGCAGGAGG + Intergenic
1106241102 13:27914350-27914372 CACATTAAAAGCAATGCTGGGGG + Intergenic
1106692174 13:32130046-32130068 AAAAAAAAAAAAAAGGCTGGGGG - Intronic
1106806241 13:33310360-33310382 CTTATAAAGAAGAAGGCTGGAGG - Intronic
1106831857 13:33592904-33592926 TAGATTATAAAGAAGGCAGGAGG + Intergenic
1108540631 13:51441816-51441838 AAAAAAAAAAAAAAGGCTGGAGG - Intronic
1109194072 13:59358770-59358792 TAAATAAAAAGGAAGCCTGGTGG + Intergenic
1109713604 13:66190488-66190510 CAAAGAAAAAAAATGGCTGGGGG + Intergenic
1110255229 13:73426124-73426146 CTATTTAAAAAGAAGGTTGGGGG - Intergenic
1110613875 13:77519906-77519928 CAAAGAAACAAGAAGGCTGGAGG + Intergenic
1110855939 13:80296806-80296828 CAAAATAACAAGAAGGAAGGGGG + Intergenic
1111173805 13:84565698-84565720 CAAGTTGAAAAGCAGTCTGGAGG + Intergenic
1111749130 13:92305448-92305470 CAATTTAAAAAAAAGGGTAGAGG - Intronic
1111834490 13:93370970-93370992 CAAATTGAAAAGACGGTTTGTGG + Intronic
1111837142 13:93401886-93401908 TAAATTAAGAATAAGGTTGGGGG + Intronic
1112264291 13:97908617-97908639 AAAATTAAAAAGAAGACTATGGG + Intergenic
1112577747 13:100652041-100652063 TAAAATAAAAACATGGCTGGAGG + Intronic
1114811482 14:25905546-25905568 AAAAAAAAAAAGAAGGGTGGGGG - Intergenic
1115134109 14:30088485-30088507 AAATTTAAAAAGCAGGTTGGAGG + Intronic
1115590668 14:34861672-34861694 TAAATTAAAGAGAAGGAAGGTGG + Intronic
1115885333 14:37965323-37965345 AAAAAAAAAAAAAAGGCTGGAGG - Intronic
1116060760 14:39921437-39921459 AAAATTAAAAAGAAGGTGTGTGG - Intergenic
1116136007 14:40924641-40924663 CCAATTAAAAAGAAGTCTGATGG - Intergenic
1116331007 14:43597883-43597905 AAAATGAGAAAGAAGGCGGGGGG + Intergenic
1116462893 14:45198052-45198074 CAAATTAAAAAGAAGGCTGGTGG - Intronic
1117218989 14:53582337-53582359 CAAAAAAAAAAAAAGGCGGGGGG - Intergenic
1117773180 14:59155207-59155229 AAAAAAAAAAAAAAGGCTGGGGG + Intergenic
1119929680 14:78533091-78533113 AAAAAAAAAAAAAAGGCTGGAGG - Intronic
1120345256 14:83280721-83280743 CAAATTGGAGAGAAGACTGGAGG + Intergenic
1120588499 14:86346480-86346502 CAATTAAAAAAGACGGCTTGGGG + Intergenic
1121960680 14:98256550-98256572 CAAATTAGAAACAAGACTGAAGG + Intergenic
1122046623 14:99028603-99028625 AAAAACAAAAAGAAGGCTGGGGG + Intergenic
1122746542 14:103900279-103900301 CAAAATAAAAAAAGTGCTGGAGG - Intergenic
1202829342 14_GL000009v2_random:9675-9697 TAAATAAAAAAGATGGCTGGGGG - Intergenic
1124037440 15:26068774-26068796 GAAAATAAAAAGAAGGAAGGAGG - Intergenic
1124042839 15:26120750-26120772 AAAAAAAAAAAAAAGGCTGGGGG - Intergenic
1124260171 15:28182489-28182511 CTCATTAGAAAGAAGGCTGCTGG - Exonic
1124378979 15:29148861-29148883 AAAATTAAAAAAAAATCTGGAGG - Intronic
1125470869 15:40002273-40002295 CAAATGAAAAAGAAAGCTATTGG + Intronic
1125854111 15:42932740-42932762 AAAAATAAAAACTAGGCTGGGGG + Intergenic
1126898318 15:53284252-53284274 AAATTTAAAAAGATGGATGGGGG - Intergenic
1127038154 15:54942702-54942724 AAAAGGAAAAAGCAGGCTGGAGG - Intergenic
1127441569 15:59014082-59014104 AAATTTAAAAATGAGGCTGGCGG - Intronic
1127804550 15:62506888-62506910 AAAAATAAAAATAAGGGTGGAGG - Intronic
1128319729 15:66684693-66684715 AAATTTAAAAAGAAGGCTTTGGG - Intronic
1128483817 15:68065292-68065314 AAAAGGAAAAATAAGGCTGGGGG + Intronic
1128506507 15:68276972-68276994 CAAATGAAATAGAATGATGGGGG - Intergenic
1128661775 15:69506597-69506619 AAAATAGAGAAGAAGGCTGGGGG - Intergenic
1129281802 15:74491029-74491051 CCAATTAAAAAGAAACCTGTTGG - Intergenic
1131031785 15:89192388-89192410 AAAATGAAAAAGAAGGCTATTGG + Intronic
1131233957 15:90680535-90680557 AACATTAAAAAGAGGCCTGGAGG - Intergenic
1133014316 16:2932286-2932308 AAAAAAAAAAAGATGGCTGGTGG + Intronic
1133544311 16:6790486-6790508 CAAAACAAAAAGAACGATGGAGG - Intronic
1133955441 16:10439525-10439547 AAAAAAAAAAAAAAGGCTGGGGG - Intronic
1134207164 16:12247721-12247743 AAAATTAAAAACTAGTCTGGAGG - Intronic
1134215597 16:12314713-12314735 TAAATCAAAAAGAATGTTGGGGG + Intronic
1135298746 16:21305995-21306017 CAAATTTAAAAGAAAACAGGAGG - Intergenic
1135355351 16:21764319-21764341 AAAAAAAAAAAAAAGGCTGGGGG + Intergenic
1135429255 16:22368502-22368524 GAAAACAAAAAGTAGGCTGGGGG - Intronic
1135593653 16:23724403-23724425 AAAATTAAAAAGAAGTCTGCGGG + Intergenic
1135926337 16:26697217-26697239 AAAATTAAGAAAAAGGCTAGAGG - Intergenic
1137766915 16:50984975-50984997 CCAATGAAAAAGGAGGCTGGTGG - Intergenic
1137866954 16:51907687-51907709 AAAAACAAAAAGAAGGTTGGAGG + Intergenic
1137971895 16:52993931-52993953 AACATTAAAAAAAGGGCTGGGGG - Intergenic
1139689750 16:68633020-68633042 AAAAAAAAAAAAAAGGCTGGGGG - Intergenic
1139718590 16:68834373-68834395 AAAAATAAAAAGGAGGCTGGTGG - Exonic
1140317909 16:73917267-73917289 CACATTTAAAAGAAGGCAGTTGG + Intergenic
1141396426 16:83709058-83709080 AAAATTAAAATGGAGGCAGGAGG + Intronic
1142577428 17:918788-918810 CAAAAAAAAAAAAAGGCCGGGGG + Intronic
1143075288 17:4337357-4337379 AAAAGGAAAAAGAAGGCTGGGGG + Intronic
1143887719 17:10077544-10077566 AGACTTAAAAAGGAGGCTGGAGG + Intronic
1143902795 17:10186704-10186726 CATATTATAAAGAAGGCTTTGGG - Intronic
1144274896 17:13656805-13656827 CAAATAAACATGAAGGCTGCTGG + Intergenic
1144691950 17:17272559-17272581 TAAATTAAAAAGAAGTTCGGAGG + Intronic
1146176828 17:30670470-30670492 AAAAAAAAAAAGAAGGCCGGGGG - Intergenic
1146380594 17:32324360-32324382 CAAATTAAATTGGACGCTGGGGG - Exonic
1146614156 17:34338707-34338729 CAAACAAAAAACAAAGCTGGAGG - Intergenic
1147163236 17:38579679-38579701 CAAAAGAAAGAGAAGGCCGGGGG + Intronic
1147774495 17:42891023-42891045 CAAATAAAAATAAAGCCTGGGGG - Intergenic
1148631791 17:49116171-49116193 AAAATTTAAAAGAAGGGAGGGGG + Intergenic
1149373347 17:56018763-56018785 TAAAATAATAAGAAAGCTGGTGG + Intergenic
1149555114 17:57568089-57568111 CAAACTGAAATAAAGGCTGGGGG + Intronic
1150434073 17:65140571-65140593 CAAATTAAGAAGATCACTGGTGG + Intronic
1151450803 17:74197130-74197152 CAAATTAAAAACCAGGGAGGGGG - Intergenic
1151710420 17:75801844-75801866 AAAAAAAAAAAAAAGGCTGGGGG - Intronic
1152966765 18:123370-123392 CAAATTAGAGAGAAAGCTAGAGG - Intergenic
1153070679 18:1101014-1101036 AAAAAAAAAAAAAAGGCTGGGGG - Intergenic
1153682382 18:7512831-7512853 CAAATGAAAGAGAAGGGAGGGGG - Intergenic
1153882885 18:9435947-9435969 AAAAAAAAAAAGAAGGCTGTTGG + Intergenic
1153923602 18:9812997-9813019 TAAATTAAAAAGTATCCTGGAGG - Intronic
1154012978 18:10591381-10591403 ATAAATAAAAATAAGGCTGGAGG + Intergenic
1154927222 18:20948686-20948708 CAAATTAGAGAGAAAGCTAGAGG + Exonic
1155049931 18:22138087-22138109 CAAATTAAAAAAAAGGGGGGGGG - Intergenic
1155516611 18:26629716-26629738 CAAAAAAAAAAAAAGGCGGGGGG - Intronic
1155582526 18:27325399-27325421 AAAAAGAAAAAGTAGGCTGGGGG + Intergenic
1155718120 18:28971965-28971987 CAAAGTAAAAACAAGAGTGGTGG + Intergenic
1155920204 18:31596113-31596135 GAAATTAAGGAGAAGGCAGGGGG - Intronic
1156067441 18:33161527-33161549 CAAATTGCAAACAAGCCTGGTGG - Intronic
1156544068 18:37946282-37946304 TAAAAGAAAAAGAAGGCTGTGGG + Intergenic
1156608453 18:38697410-38697432 AAAATAAAAAAGAATGGTGGTGG - Intergenic
1156641556 18:39107267-39107289 AAAAAAAAAAAAAAGGCTGGGGG - Intergenic
1156914554 18:42449723-42449745 TAAATTGAAAAGAGGCCTGGAGG - Intergenic
1156916702 18:42470446-42470468 CAAATGAAATAGAAGGTGGGAGG - Intergenic
1157268808 18:46253081-46253103 CATCTAAAAAGGAAGGCTGGAGG - Intronic
1158203653 18:54966875-54966897 CAAATGAAAACTAGGGCTGGGGG + Intergenic
1158342828 18:56485140-56485162 TAAATTAAACATAAAGCTGGGGG + Intergenic
1158632340 18:59126481-59126503 CAAATTAATAAGAAGGGAGAGGG + Intergenic
1158926387 18:62267350-62267372 CAAATTAAAAATGGGGGTGGGGG - Intronic
1159465263 18:68774053-68774075 CAAATTAAAAATTAGGCAGGTGG + Intronic
1159843721 18:73432527-73432549 CAAAAAAAAAACAAAGCTGGAGG + Intergenic
1160192328 18:76724192-76724214 CAAAATAAAAATCAGGCTTGAGG + Intergenic
1161095548 19:2388391-2388413 CAAACAAAAAAGGAGGCGGGAGG + Intergenic
1161260470 19:3335223-3335245 AAAAAAAAAAAAAAGGCTGGAGG + Intergenic
1161502795 19:4626425-4626447 AAAAAAAAAAAAAAGGCTGGTGG - Intergenic
1162177291 19:8840460-8840482 AAAATTAAAAAGTTAGCTGGGGG - Intronic
1162434529 19:10649410-10649432 AAAAACAAAAAGAAGGCTGGGGG - Intergenic
1162845187 19:13386949-13386971 CAAAAACAAAAGAAGTCTGGAGG - Intronic
1163610849 19:18300863-18300885 AACATTAAAAAAATGGCTGGGGG - Intergenic
1163624937 19:18383731-18383753 AAAAAAAAAAAAAAGGCTGGGGG + Intronic
1164167816 19:22698649-22698671 AAAAAAAAAAAAAAGGCTGGGGG - Intergenic
1165197647 19:34117455-34117477 AAAATTTAAAAAAAGGATGGTGG - Intergenic
1165293499 19:34907534-34907556 CAAAGTACAAAGTAGGCTTGAGG - Intergenic
1165468219 19:35987478-35987500 TAAATTAAAAATTAGGCGGGGGG + Intergenic
1165584658 19:36903513-36903535 CAAATTATAAAGAAAGATGTGGG - Intronic
1165704706 19:37967249-37967271 CAAAAAAAAAAAAAGGGTGGGGG - Intronic
1166349727 19:42190542-42190564 CAAATGAGGCAGAAGGCTGGGGG + Intronic
1167251863 19:48403210-48403232 AAAAAAAAAAAAAAGGCTGGAGG + Intronic
1167489145 19:49781815-49781837 CAAGTTCAAAGGTAGGCTGGGGG + Exonic
1202643350 1_KI270706v1_random:118107-118129 TAAATAAAAAAGATGGCTGGGGG + Intergenic
926378554 2:12260752-12260774 AAAAAAAAAAAAAAGGCTGGAGG + Intergenic
926418521 2:12674688-12674710 CTAATTGAAAAGAGGGCAGGTGG - Intergenic
927605484 2:24482937-24482959 CTAATAAAAAATAAGGCTGTTGG + Intergenic
928041435 2:27881620-27881642 CTAAGGAAAAAGAAAGCTGGAGG + Intronic
928248073 2:29649335-29649357 CAAATTAAAACAAAGGTCGGTGG - Intronic
928581664 2:32714155-32714177 CAAAAAAAAAAAAAGGCGGGGGG - Intronic
929016502 2:37502667-37502689 CACAAGAAAAAGAAGGTTGGTGG + Intergenic
929361522 2:41097626-41097648 CTAATTAAAATGAAGGCAGGAGG + Intergenic
929574909 2:43045373-43045395 CAAAGGAAAAAGAAAGTTGGGGG - Intergenic
932149161 2:69353373-69353395 CAAATAAAAAAATTGGCTGGGGG + Intronic
932717883 2:74116015-74116037 AAAAAAAAAAAAAAGGCTGGAGG + Intergenic
933346926 2:81099019-81099041 CTGATCAAAAAGAAAGCTGGAGG - Intergenic
935334971 2:102007697-102007719 CCTATTGAAAAGCAGGCTGGAGG + Intronic
937540359 2:122943543-122943565 CCAATTAAAAGGCAGACTGGAGG + Intergenic
938848900 2:135239982-135240004 CAAAAAAAAAAAAAGGGTGGAGG + Intronic
939020738 2:136955530-136955552 CAAATTTAAAAGAACTCTGAGGG - Intronic
939372242 2:141316267-141316289 CAAATTAAAAATGAAGCTTGAGG + Intronic
939384452 2:141477465-141477487 CAAATTAGGAGGAAGGCTGAGGG + Intronic
939606560 2:144262409-144262431 AAAATTAAAAAATAAGCTGGGGG + Intronic
942076056 2:172358160-172358182 GAATTAAAAAGGAAGGCTGGGGG - Intergenic
942934029 2:181532196-181532218 CTAAGCAAAAAGAAAGCTGGAGG - Intronic
943117283 2:183689697-183689719 AAAGTTAAAAAGTAGTCTGGGGG - Intergenic
943389347 2:187244395-187244417 AGAATTAAAAATAAGGCTGCTGG + Intergenic
945686563 2:212977859-212977881 CAAATTACAAAGAGGGAGGGAGG - Intergenic
945875088 2:215269571-215269593 CCAATTAAGAAAAAGGCTGTAGG - Intergenic
945925571 2:215799954-215799976 CAAATTATAAAGAAGACCGAAGG + Intergenic
946184536 2:217972392-217972414 CAACTGTAAAAGAAGGCTGCAGG + Intronic
947613069 2:231535924-231535946 AGAATCAACAAGAAGGCTGGAGG + Intergenic
947975203 2:234359643-234359665 CAAACAAAAAACAAAGCTGGAGG - Intergenic
948315181 2:237023043-237023065 CACATGAGTAAGAAGGCTGGTGG - Intergenic
949003984 2:241635038-241635060 CAAAATAAAAATAATTCTGGAGG + Intronic
949066817 2:241996001-241996023 CACATTGAGAAGGAGGCTGGTGG - Intergenic
1169270606 20:4196303-4196325 AAAAAAAAAAAGAGGGCTGGTGG + Intergenic
1169475458 20:5927117-5927139 AAAAAAAAAAAGAAGGCTGCTGG - Intergenic
1169751541 20:8999563-8999585 CAAAGTAAAAAGCAATCTGGAGG + Intergenic
1170005826 20:11667928-11667950 CCAATTAAAAAGAAAGCTGGAGG - Intergenic
1170639111 20:18136340-18136362 CAAATAAAAAAGTGGGTTGGGGG - Intergenic
1170931869 20:20775826-20775848 AAAATAAAAAAGAAAGCTGGAGG - Intergenic
1170959621 20:21013620-21013642 CAAATTACAAAGAATCTTGGTGG + Intergenic
1171890472 20:30708310-30708332 TAAGTAAAAAAGATGGCTGGGGG + Intergenic
1172267092 20:33625798-33625820 AAAATTAAAAATGAGGCAGGAGG + Intronic
1174283341 20:49454935-49454957 AAAAAAAAAAGGAAGGCTGGGGG + Intronic
1174334880 20:49852830-49852852 CAAAACAAACAAAAGGCTGGGGG - Intronic
1174373277 20:50108665-50108687 CAACTTAAAAAGAAGTCTGATGG + Intronic
1174457317 20:50658762-50658784 CATCTTTTAAAGAAGGCTGGAGG - Intronic
1175069986 20:56325098-56325120 CAACTAAAAATTAAGGCTGGTGG + Intergenic
1175530446 20:59671255-59671277 TACATTCACAAGAAGGCTGGGGG + Intronic
1175575552 20:60058133-60058155 GAAATTAAATAGGAGGCTGGTGG + Intronic
1176608526 21:8854515-8854537 TAAATAAAAAAGATGGCTGGGGG - Intergenic
1177904826 21:26962853-26962875 AAAAAAAAAAAGAAGTCTGGAGG - Intronic
1178195536 21:30340630-30340652 GAAATTAATAAGAAGGCTGCTGG - Intergenic
1178245324 21:30945091-30945113 CAAAATAAAAAAAAAGATGGTGG + Intergenic
1178471799 21:32900247-32900269 CAAAAAAAAAAAAAAGCTGGAGG + Intergenic
1179195518 21:39159189-39159211 CAAGGTAGAAAGAAGGCTAGGGG + Intergenic
1179218054 21:39384032-39384054 CAAAAAAAAAAAAAGGCCGGGGG - Intronic
1180358611 22:11864330-11864352 TAAATAAAAAAGATGGCTGGGGG - Intergenic
1180379655 22:12128001-12128023 TAAATAAAAAAGATGGCTGGGGG + Intergenic
1182827233 22:33276220-33276242 GAAAAAAAAAAAAAGGCTGGAGG + Intronic
1183123602 22:35752737-35752759 CAAAGGAAAGAAAAGGCTGGTGG - Intronic
1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG + Intronic
1185229352 22:49671166-49671188 CAGATGAAAAGGAAGGCAGGTGG + Intergenic
949117663 3:347382-347404 TAAATTTAAAAAAAGGCAGGAGG + Intronic
949352631 3:3140020-3140042 GAAATTAAAATAAAGGCTGGGGG - Intronic
949460326 3:4284756-4284778 CAAAATATAAAGAAGCATGGGGG + Intronic
950083563 3:10240550-10240572 CAAAAAAAAAAAAAGGCGGGGGG - Intronic
950986874 3:17381670-17381692 CAAACCAAAAAGGAGACTGGGGG - Intronic
950995902 3:17495273-17495295 CAAATAAAAAAGGAAGCAGGAGG - Intronic
951158229 3:19381531-19381553 CAAATGAGAAAAAATGCTGGCGG + Intronic
951863931 3:27285978-27286000 AAAATTAAAAATAAAGCTAGAGG - Intronic
952498513 3:33936928-33936950 AAAATTAGAAAGAAGGGAGGTGG - Intergenic
952573782 3:34749133-34749155 CAAATAAAAACGAGGGCTGATGG - Intergenic
953497529 3:43401137-43401159 CAAACAAAACAAAAGGCTGGGGG - Intronic
954051750 3:47984986-47985008 AAAAATAAAAATTAGGCTGGGGG + Intronic
954129239 3:48551508-48551530 AAAAAAAAAAAGAAGGCTGGAGG - Intronic
954490171 3:50896926-50896948 CTAAGCAAAAAGAAAGCTGGAGG - Intronic
955109949 3:55938706-55938728 CAAAATAAAAACAAGTCTGCTGG + Intronic
955129617 3:56152404-56152426 CAATTTAAAATGAAGGGGGGGGG + Intronic
955131042 3:56168953-56168975 CAATTAAAAAAAAAGCCTGGTGG + Intronic
955579799 3:60406655-60406677 CAAATTCTAGAGAAGGATGGTGG + Intronic
955695616 3:61633023-61633045 CAAATCAAGAAGAAGGATGGTGG - Intronic
957562320 3:81838337-81838359 CAAGTTAAAAAGAAGGTTTTGGG + Intergenic
957716932 3:83939734-83939756 GAAATAAAAAACAAAGCTGGAGG - Intergenic
958565625 3:95806047-95806069 CAATTTGTAAAGAATGCTGGAGG - Intergenic
958827173 3:99044624-99044646 CAAAAAAAAAAGAAAGCTGCAGG + Intergenic
958959809 3:100498435-100498457 CAAGTTCAAAGGCAGGCTGGAGG - Intronic
959455162 3:106550629-106550651 CAACTTAAAAAAATGGCCGGGGG - Intergenic
959650119 3:108743357-108743379 CAAATTAAAGAGAAGGTGGCAGG - Intergenic
960250396 3:115445226-115445248 CAAACAAAAAACAAAGCTGGAGG + Intergenic
961347294 3:126272118-126272140 CAAATTAACAACAAGGTTTGGGG + Intergenic
962168928 3:133080124-133080146 CACATGAAAAAGAAGCCTAGAGG + Intronic
962257631 3:133883412-133883434 CAAATTTAATGAAAGGCTGGAGG - Intronic
962712524 3:138100022-138100044 CAAAAAAAAAAAAAGGATGGGGG - Intronic
963049326 3:141128037-141128059 GAGAAGAAAAAGAAGGCTGGTGG + Intronic
964186343 3:153949008-153949030 CATATGAGAAAGAAGGCAGGGGG + Intergenic
964748672 3:160035046-160035068 AAAATAAATAAGTAGGCTGGGGG - Intergenic
964750598 3:160050670-160050692 AAAAAAAAAAAGAATGCTGGTGG - Intergenic
964949702 3:162274980-162275002 CAACAAAAAAAGAAAGCTGGAGG - Intergenic
965064007 3:163821196-163821218 AAAAAAAAAAACAAGGCTGGAGG + Intergenic
965537237 3:169835975-169835997 CAAATGAAAGAGGTGGCTGGGGG - Intronic
965634002 3:170762615-170762637 AAAATTAAAAAGCAGGCTAAGGG + Intronic
965684780 3:171290618-171290640 CAAATTACAAAGATGACTGTGGG - Intronic
965742852 3:171894358-171894380 CAAATTCAAGAGCAGGCTGCAGG + Intronic
966323274 3:178724941-178724963 AAAAATAAAAATAAAGCTGGAGG - Intronic
967313432 3:188128045-188128067 CAAAACAAAAAGAAAGATGGGGG + Intergenic
967447968 3:189589151-189589173 CAAAATAAAAAGAGGTCTTGTGG - Intergenic
968408470 4:363758-363780 CAAAAAAAAAAAAAGGCGGGGGG + Intronic
969349665 4:6591150-6591172 CAAAAAAAAAAGAAGGCTGGAGG + Intronic
969633954 4:8354463-8354485 CAAACTAATACGAAGGCTGAAGG + Intergenic
969909934 4:10435003-10435025 GAAATTAAAAATAAAGATGGGGG - Intergenic
970963459 4:21899969-21899991 AAAATTAAAAAAAAAACTGGAGG + Intronic
971321901 4:25612455-25612477 CAATCTATTAAGAAGGCTGGTGG - Intergenic
971883634 4:32413663-32413685 CTAAGCAAAAAGAAAGCTGGAGG + Intergenic
972891434 4:43560762-43560784 CACATGAAAAAGAAATCTGGAGG + Intergenic
973071891 4:45870697-45870719 TACATTAAAATGAAGGCTGTAGG - Intergenic
973559143 4:52116890-52116912 CAAACTAATTAGAAGTCTGGTGG + Intergenic
973686650 4:53377453-53377475 GTTATTAAAAAGAAGGGTGGGGG + Intergenic
973725083 4:53767298-53767320 CAAATAATAAAGTAGGGTGGTGG + Intronic
974585289 4:63866445-63866467 AAAATTAAAAGGAAGGCAGAAGG + Intergenic
975601399 4:76103821-76103843 CAAAAAAAAAAAAAGGCAGGGGG - Intronic
976030502 4:80747079-80747101 CAAATTAAATAGAAAGCAGAAGG - Intronic
976334056 4:83865232-83865254 AAAACTTAAAAGAAGGCGGGGGG - Intergenic
976710062 4:88060656-88060678 CAAAGTAAAAAAAAAGTTGGTGG + Intronic
976900675 4:90171145-90171167 AAAATTAAAAAAAAGTCTTGTGG + Intronic
977505165 4:97892989-97893011 TAAATTAAAAAGATAACTGGTGG + Intronic
977594959 4:98868369-98868391 CAAATTAAAAAGAAGCTGGAGGG - Intergenic
977649161 4:99449681-99449703 CAAAACAAAAACAAAGCTGGAGG - Intergenic
977700377 4:100015310-100015332 CAAATGAAAGAGAAGGATAGAGG - Intergenic
978302376 4:107285404-107285426 CAAATTAAAAAGGATGCTTGTGG - Intergenic
978571274 4:110140545-110140567 AAAATTAAAAAGAAGCATGGTGG - Intronic
978704352 4:111688644-111688666 CAGATTAAAATGAAGGCTCTGGG - Intergenic
979108836 4:116724076-116724098 CTAATTGAAAAGAAGGGTGCAGG + Intergenic
979580220 4:122349762-122349784 CAAATTAAAAAGCTGGGCGGGGG + Intronic
980090504 4:128437941-128437963 CAAACAAAAAACAAAGCTGGAGG - Intergenic
981509957 4:145545047-145545069 CAAGTTAAAAAAAAAGCGGGGGG - Intronic
981580174 4:146242763-146242785 AAAAAAAAAAAGAAGGCGGGGGG - Intergenic
982316070 4:154033458-154033480 CAAAAAAAAAAAAAGGATGGTGG + Intergenic
982403419 4:154994257-154994279 AATATTAAAGAGAAGTCTGGGGG - Intergenic
982885315 4:160772859-160772881 CAAAGTAGAAAGCAGGCTGCAGG - Intergenic
983579501 4:169293384-169293406 CAAACTAAAAAATAGGCTTGTGG + Intergenic
985247642 4:187993978-187994000 GAAACAAAAAAAAAGGCTGGTGG + Intergenic
1202770723 4_GL000008v2_random:204017-204039 TAAATAAAAAAGATGGCTGGGGG + Intergenic
985485878 5:148777-148799 AAAAATAAAAACAAAGCTGGAGG + Intronic
985959751 5:3292189-3292211 AAAGTTAAAAAGAATTCTGGAGG + Intergenic
986308352 5:6532294-6532316 TGAATTAAAAAGAAGGTGGGAGG + Intergenic
986359519 5:6962973-6962995 CAAATGAAACAGAAGAGTGGAGG + Intergenic
987277167 5:16374361-16374383 CACATTAATAAGGAGGCTGGAGG - Intergenic
988413142 5:30912266-30912288 CAAATGAAAAATAAGGAAGGTGG - Intergenic
988545420 5:32152425-32152447 AAAAAAAAAAAAAAGGCTGGGGG - Intronic
988745783 5:34135689-34135711 CAAACAAAAAACAAAGCTGGAGG + Intergenic
988946487 5:36206834-36206856 CAATAAAAAAAGTAGGCTGGAGG - Intronic
989967244 5:50478852-50478874 CAAATTAAAGAGAAGGATATAGG + Intergenic
990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG + Intergenic
990703416 5:58500086-58500108 CAATTTAAAAGGAAGGATGTTGG + Intergenic
992153521 5:73930685-73930707 CAAATAAAAAACAAGGCAGATGG - Intronic
992717014 5:79520940-79520962 CTTATTAAAAAGAAGTCTGAAGG + Intergenic
993407461 5:87529300-87529322 CAAAAGGAAAAAAAGGCTGGGGG + Intergenic
994049866 5:95350088-95350110 CAAATTTAAAAGTTAGCTGGAGG - Intergenic
994251135 5:97538843-97538865 GAAATAAGAAAGAAGGCTTGTGG - Intergenic
995277517 5:110294072-110294094 ATAATTAAAAAGAAGGCAGAGGG + Intronic
995530867 5:113090909-113090931 GAAATGAGAAAGAAGGCTGAAGG + Intronic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
997079110 5:130717153-130717175 CAAATTAAAACAACTGCTGGAGG + Intergenic
998110593 5:139499362-139499384 CAAAAGAAAAAGTAGGCTGGGGG - Intergenic
998314355 5:141167673-141167695 AAAATATAAAAGAAGGCTAGTGG - Intergenic
998438947 5:142139700-142139722 CAAAGTCAAGACAAGGCTGGAGG + Intronic
999480375 5:151942565-151942587 AAAAAGAAAAAGAAGGCCGGGGG - Intergenic
999541594 5:152580550-152580572 CTAAGCAAAAAGAAAGCTGGAGG - Intergenic
999632333 5:153583897-153583919 CACATTAGAAAGAATGTTGGGGG - Intronic
999789795 5:154928663-154928685 CAGATTAAAAAGAAGGCCAGTGG + Intronic
1000182375 5:158823932-158823954 CAAATTAAAAAAAAAACTGGTGG + Intronic
1000433851 5:161183705-161183727 AAAATTATTAAGAAGGCTGTAGG + Intergenic
1000483012 5:161803439-161803461 CAAAATAAAAAAAATGTTGGTGG - Intergenic
1000865439 5:166508360-166508382 AAAAGTAAAAAGAAAGCTGAAGG - Intergenic
1001621018 5:173085234-173085256 AAAATTAAAATTCAGGCTGGGGG - Intronic
1001876720 5:175207957-175207979 CAAACAAAAATTAAGGCTGGTGG + Intergenic
1002198937 5:177516287-177516309 CACCTTAAAGAGAAGGCTGAAGG - Exonic
1002355302 5:178623729-178623751 AAAATTAAAAAAAAGCCGGGGGG + Intronic
1002786784 6:407132-407154 CAAATTAAAAGGAAGTCTGAGGG - Intronic
1003854016 6:10253703-10253725 CAAAAAAAAAAGGAAGCTGGTGG - Intergenic
1004553781 6:16675452-16675474 AAAATTAAAACGAAGGGTGGAGG + Intronic
1005001620 6:21247573-21247595 CAAACAAAAAAAAAGGCTGCAGG - Intergenic
1005543944 6:26843924-26843946 CAAACAAAAAACAAAGCTGGAGG + Intergenic
1005909609 6:30297042-30297064 CGAATGAAAAAGAGGGATGGGGG - Intergenic
1006760134 6:36453303-36453325 AAAATAAAACAAAAGGCTGGGGG - Intronic
1007051745 6:38838395-38838417 CAAAAAAAAAAGAAGGCAAGGGG - Intronic
1007611324 6:43151200-43151222 AAAAAAAAAAAGAAGGCAGGTGG - Intronic
1007611444 6:43151843-43151865 CAAATAAAAAAAAAGGCGGGGGG - Intronic
1007612258 6:43157996-43158018 TTAATTAAAAAGTAAGCTGGGGG + Intronic
1008412928 6:51203956-51203978 AAATTTAAAAAGGAGGCAGGTGG + Intergenic
1009014724 6:57885594-57885616 CAAACAAAAAACAAAGCTGGAGG + Intergenic
1009037158 6:58131415-58131437 CTAAGCAAAAAGAAAGCTGGAGG - Intergenic
1009914259 6:69973362-69973384 CAAATGAAAAAGAAAGCAGTGGG - Intronic
1009974635 6:70659730-70659752 AAAAAAAAAAAAAAGGCTGGTGG + Intergenic
1010687031 6:78865420-78865442 CAAAATAAAAACAAAGGTGGGGG - Intergenic
1011291836 6:85785114-85785136 CAAATTCAAAAGCAGGCAGAAGG - Intergenic
1012032566 6:94090861-94090883 CATACTAAAAAGAGGGCAGGTGG - Intergenic
1012183596 6:96186435-96186457 CATACTAAGAAGAAGGCTGCAGG - Intronic
1012613105 6:101240475-101240497 CAAATTAAAAAGAAGTATATGGG + Intergenic
1013083882 6:106838545-106838567 CAAAATAAAAAGCCTGCTGGGGG - Intergenic
1014122342 6:117739924-117739946 TAAAAAACAAAGAAGGCTGGAGG + Intergenic
1014153593 6:118086622-118086644 CAAAGAACAAAGGAGGCTGGAGG - Intronic
1014673437 6:124335483-124335505 GAATTTGAAATGAAGGCTGGGGG + Intronic
1015115192 6:129640604-129640626 TAATTTAAAAAGAAGACTTGGGG - Intronic
1015153593 6:130065259-130065281 CATAGTAAAAAGAAGTCCGGAGG - Intronic
1015560831 6:134513653-134513675 CAAATTAGAAATAAAGATGGGGG + Intergenic
1015704619 6:136074230-136074252 CAAAAAAAAAAAAAGGCGGGGGG + Intronic
1016199498 6:141391063-141391085 CAAATTAAGAAGGAGAATGGAGG + Intergenic
1016306577 6:142690779-142690801 AAAATTAAAAATGAGACTGGTGG + Intergenic
1016537985 6:145130048-145130070 TAAAGAAAAAAAAAGGCTGGAGG - Intergenic
1017381845 6:153840269-153840291 CAAAGCAATAAGAAGGCTAGAGG - Intergenic
1017549926 6:155495272-155495294 CAAATTAAGAAGAATCCTGGGGG + Intergenic
1018108944 6:160516621-160516643 CAAAAAAAAAACAAAGCTGGAGG + Intergenic
1018199756 6:161383912-161383934 CAAACTAAAAAGATGTCTGCTGG - Intronic
1019907060 7:4072837-4072859 CGAATTAAAATGGAAGCTGGGGG - Intronic
1020991706 7:15205109-15205131 CAAATTACAAAGAAATGTGGTGG + Intronic
1021515864 7:21486211-21486233 CAAAATAAAAATAAAGCTGCAGG - Intronic
1022093208 7:27121642-27121664 CAAATTTAAGGGAAGACTGGAGG + Intronic
1022200398 7:28110958-28110980 AAAATTAAAAACTAGGGTGGGGG + Intronic
1023013752 7:35945121-35945143 AAAAAAAAAAAGGAGGCTGGTGG + Intergenic
1023040510 7:36168757-36168779 CAAAAAAAAAAAAAGGTTGGGGG + Intronic
1023920517 7:44625974-44625996 AAAATTTAAAAGAAGGTGGGGGG + Intronic
1024077378 7:45828716-45828738 AAAAAAAAAAAGGAGGCTGGTGG - Intergenic
1024471436 7:49771765-49771787 CAAAATAAAAACACGGCTCGAGG - Intergenic
1024489329 7:49959796-49959818 TAAAATAAAAACAAAGCTGGAGG + Intronic
1024663392 7:51520996-51521018 CAAATGAAAAGCAAGGCAGGGGG - Intergenic
1024771071 7:52723935-52723957 AAAAGGAAAAAGAAGGCCGGGGG - Intergenic
1025096092 7:56096463-56096485 AAAAATAAAAATAGGGCTGGGGG - Intergenic
1025127031 7:56352687-56352709 AAAAAAAAAAAGGAGGCTGGTGG + Intergenic
1025602347 7:63012602-63012624 AAAAAAAAAAAGGAGGCTGGTGG + Intergenic
1025709751 7:63898292-63898314 CAATTTAAAAAGCAGGCAGTAGG + Intergenic
1027450321 7:78324238-78324260 AAAAAAAAACAGAAGGCTGGTGG + Intronic
1028514801 7:91665479-91665501 GAATTTAAAAACAAAGCTGGTGG + Intergenic
1028888467 7:95960519-95960541 AACAAGAAAAAGAAGGCTGGTGG - Intronic
1029761409 7:102602957-102602979 CAAAAAAAAAAAAAAGCTGGAGG - Intronic
1029805423 7:102991014-102991036 CAAATGAAAAATAAGTCAGGTGG + Intronic
1030073836 7:105720034-105720056 CATCTTAATAAGAAGCCTGGTGG + Intronic
1031277916 7:119754715-119754737 CAAATAAAAAAGAAGTGGGGAGG + Intergenic
1031632121 7:124055898-124055920 GTAATTAAAAACAAGGCGGGGGG + Intergenic
1031711247 7:125048585-125048607 CAAAATAAAAAGAAAAGTGGAGG + Intergenic
1031797009 7:126187277-126187299 GAAATTAAGAAGAAGGCTATGGG + Intergenic
1032111486 7:129079678-129079700 AAATTAACAAAGAAGGCTGGGGG - Intergenic
1033169838 7:139073789-139073811 CAACTTAAAAAGAACACTGTTGG - Intronic
1033398073 7:140994434-140994456 CAAATGAACAAAAAGACTGGAGG - Intergenic
1034160968 7:148994062-148994084 AAAATAAAAATAAAGGCTGGAGG - Intergenic
1034306359 7:150047936-150047958 CAGATTAAAAAAAAGGCGGTGGG + Intergenic
1035131348 7:156656915-156656937 CAAATGAAGAAGAAGGCAGTGGG - Intronic
1035421493 7:158732613-158732635 GAATTTATAAACAAGGCTGGTGG - Exonic
1035931219 8:3782492-3782514 CTTTTTAAAAAGGAGGCTGGGGG + Intronic
1036013385 8:4753483-4753505 GAAATGAAAAAGAAGAATGGAGG - Intronic
1036466990 8:9007711-9007733 CTAAGTAAAAAGAAGACTGGTGG - Intronic
1036983257 8:13495360-13495382 CAAATTCCAAAGTAGTCTGGAGG - Intronic
1037367659 8:18140123-18140145 CAAATTAAAAACAAGGCCTAAGG + Intergenic
1038210676 8:25516745-25516767 CAAAAAAAAAAAAAGGCAGGGGG - Intergenic
1038387153 8:27159387-27159409 CAAAATAAAGAGAAGCCTGTGGG - Intergenic
1038605158 8:28994167-28994189 CAAAAAAAAAAAAAGGCGGGGGG + Intronic
1039137748 8:34345483-34345505 CGAAGCAAAAAGAAAGCTGGAGG - Intergenic
1040856828 8:51957295-51957317 CAAATTAAAATGGAGAATGGAGG + Intergenic
1041093087 8:54321989-54322011 CTAACTAAAAAGAAGGAGGGAGG + Intergenic
1041123598 8:54611928-54611950 CAAATAAAAAAGAAAGGTTGGGG - Intergenic
1041170485 8:55137194-55137216 CAAAGTCAAAAGAAAGTTGGAGG + Intronic
1041544297 8:59024582-59024604 CAAATTATAAAGAGGGCTGCTGG - Intronic
1041740495 8:61152009-61152031 GAAATAGAAAAGAAAGCTGGGGG - Intronic
1042811808 8:72833878-72833900 AAAATTAACAGGAAGGGTGGTGG - Intronic
1042850444 8:73211227-73211249 CAAAATAATAATAATGCTGGGGG - Intergenic
1042924585 8:73954136-73954158 TAAATTAGAAAGCAGACTGGTGG + Intronic
1043058566 8:75471597-75471619 GAAATTAATAAGAAGGAAGGAGG - Intronic
1043303065 8:78759062-78759084 CAGATTAAAAAAAAAGGTGGGGG - Intronic
1043572279 8:81618480-81618502 AAAAAAAAAAAAAAGGCTGGAGG + Intergenic
1043812413 8:84757616-84757638 AGAATTAAAAAGAGGGATGGAGG + Intronic
1043820479 8:84857154-84857176 ATAATGAAAAGGAAGGCTGGAGG + Intronic
1044700588 8:94962287-94962309 AAAAATAAAAAGCAGTCTGGAGG - Intronic
1045109095 8:98922372-98922394 TCACTTAATAAGAAGGCTGGAGG - Intronic
1045154421 8:99451283-99451305 GAAATACAAAAAAAGGCTGGAGG - Intronic
1045379343 8:101607625-101607647 AAAAGTAAAAATAGGGCTGGGGG + Intronic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1046423648 8:114016833-114016855 AAAATTAATAAGAAGACAGGGGG - Intergenic
1048347941 8:133592073-133592095 CAATTTAAAATGAAGGAAGGGGG + Intergenic
1049046157 8:140153380-140153402 CAATTTAAAAAGAATGATAGGGG - Intronic
1050630477 9:7553386-7553408 CAAACAAAAAACAAAGCTGGGGG + Intergenic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052212442 9:25921978-25922000 CAAATAAAAAAAAAGGCTGGGGG + Intergenic
1052273175 9:26648974-26648996 GAATTTAAAAAGAAGGTAGGTGG - Intergenic
1052431013 9:28366549-28366571 GAAATGAAAAAGAATGCTGGAGG + Intronic
1053325678 9:37147469-37147491 AAAATTAAAAATAAGAGTGGGGG + Intronic
1054810765 9:69432300-69432322 CAGATGAAAGAGAAGGCTGAGGG + Intronic
1054936842 9:70697152-70697174 CAAATTAAAACTAAAGCTGGTGG + Intronic
1055687338 9:78790856-78790878 GAAATGGAAAAGCAGGCTGGTGG + Intergenic
1055833325 9:80408636-80408658 CAATCTTTAAAGAAGGCTGGGGG + Intergenic
1056136192 9:83631457-83631479 AAAAAAAAAAAAAAGGCTGGTGG + Intronic
1056214133 9:84392360-84392382 CAAATAAAAGAAAAGGCTGGGGG - Intergenic
1057759121 9:97858700-97858722 AAAAAAAAAAAAAAGGCTGGCGG + Intergenic
1058039487 9:100288330-100288352 CAAATCAAAAAGAAGCCTCTGGG - Intronic
1058279463 9:103094680-103094702 CAAATGAAAAATAATCCTGGGGG + Intergenic
1058509334 9:105699652-105699674 AAAGTTACATAGAAGGCTGGAGG - Intronic
1058566317 9:106289005-106289027 CAACGTAACAAGAAGGGTGGAGG - Intergenic
1059148667 9:111926853-111926875 AAAAAAAAAAAAAAGGCTGGGGG - Intronic
1059568102 9:115404051-115404073 AAAAATAGAAAGAAGGGTGGAGG - Intergenic
1059755339 9:117288408-117288430 CAAATCTCAAAGAAGTCTGGAGG - Intronic
1060747076 9:126144636-126144658 CACAAAAAAAAGAAGGCTGCAGG + Intergenic
1060889367 9:127178241-127178263 CAAATCCAATAGAAAGCTGGGGG + Intronic
1062119778 9:134827994-134828016 CAGCTCAAGAAGAAGGCTGGGGG + Intronic
1203784016 EBV:117072-117094 CAGCTTATAAAGAAAGCTGGTGG - Intergenic
1203703927 Un_KI270742v1:19735-19757 TAAATAAAAAAGATGGCTGGGGG - Intergenic
1203560089 Un_KI270744v1:46089-46111 TAAATAAAAAAGATGGCTGGGGG + Intergenic
1185684556 X:1917645-1917667 CAAAAGAAAAAGAAGGGGGGGGG + Intergenic
1186954298 X:14664795-14664817 CTCTTTAAAGAGAAGGCTGGAGG + Intronic
1187149245 X:16667129-16667151 CAAAAAAAAAAAAAGGCGGGGGG - Intronic
1187639392 X:21272225-21272247 CAAATTAGAAAAATGGATGGTGG + Intergenic
1187991410 X:24877484-24877506 CTACTTAAAAAGGAGGCTGGAGG + Intronic
1188140352 X:26542849-26542871 CAAAACCAAAACAAGGCTGGAGG + Intergenic
1188460311 X:30418249-30418271 CAAAACAAAAAGAAAGCAGGTGG - Intergenic
1189490142 X:41464869-41464891 GAAAATAAAAAGAAGACTGGGGG - Intronic
1189737951 X:44090431-44090453 CAAAAAAAAAAGAAGCATGGGGG - Intergenic
1189975776 X:46460417-46460439 CAAAAAAAAAAAAAAGCTGGGGG + Intronic
1191588765 X:62858070-62858092 CAAATTTACAAGAAAGGTGGTGG + Intergenic
1192521585 X:71806188-71806210 GAAATAAAAAAGAAAGCTGCAGG + Intergenic
1192610882 X:72565847-72565869 GAATTTAAAAAAAAGGCAGGCGG + Intronic
1193405584 X:81097195-81097217 CAAGTAAAAAAGGAGGCTGTTGG - Intergenic
1194287217 X:92024738-92024760 CAAAACAAAAACAAAGCTGGAGG + Intronic
1194587412 X:95753003-95753025 CAAACAAAAAACAAAGCTGGAGG - Intergenic
1195415248 X:104612615-104612637 CTAAACAAAAAGAAAGCTGGAGG - Intronic
1195447855 X:104974608-104974630 CAAATAAAGAAGGAAGCTGGGGG + Intronic
1196153336 X:112399199-112399221 CAAATAAAAAAGAGGGTTGAAGG - Intergenic
1196960723 X:120997713-120997735 AAAATTAAAAAGTTGGCTGGTGG - Intergenic
1197308989 X:124880982-124881004 CAATTTAAAAAGAAAGCTATAGG - Intronic
1198032976 X:132772361-132772383 CAAATGAAAAAGAGGGATTGGGG - Intronic
1198630334 X:138630164-138630186 CAGCTCAAAAAGAATGCTGGGGG + Intergenic
1201413121 Y:13721247-13721269 CATATTAAAGAGGAGGCTGCAGG + Intergenic