ID: 1116476337

View in Genome Browser
Species Human (GRCh38)
Location 14:45344842-45344864
Sequence TCAGCCATGACTTTTTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116476337_1116476338 1 Left 1116476337 14:45344842-45344864 CCTCTTTAAAAAGTCATGGCTGA No data
Right 1116476338 14:45344866-45344888 AAATACTACATTCCATACTTCGG No data
1116476337_1116476340 3 Left 1116476337 14:45344842-45344864 CCTCTTTAAAAAGTCATGGCTGA No data
Right 1116476340 14:45344868-45344890 ATACTACATTCCATACTTCGGGG No data
1116476337_1116476339 2 Left 1116476337 14:45344842-45344864 CCTCTTTAAAAAGTCATGGCTGA No data
Right 1116476339 14:45344867-45344889 AATACTACATTCCATACTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116476337 Original CRISPR TCAGCCATGACTTTTTAAAG AGG (reversed) Intergenic
No off target data available for this crispr