ID: 1116482211

View in Genome Browser
Species Human (GRCh38)
Location 14:45405034-45405056
Sequence GGTGCAATAATTCATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116482208_1116482211 -9 Left 1116482208 14:45405020-45405042 CCCAGGGAAGGAAAGGTGCAATA No data
Right 1116482211 14:45405034-45405056 GGTGCAATAATTCATGTGGAAGG No data
1116482209_1116482211 -10 Left 1116482209 14:45405021-45405043 CCAGGGAAGGAAAGGTGCAATAA No data
Right 1116482211 14:45405034-45405056 GGTGCAATAATTCATGTGGAAGG No data
1116482203_1116482211 12 Left 1116482203 14:45404999-45405021 CCTCTGCATTACTGGGAAACACC No data
Right 1116482211 14:45405034-45405056 GGTGCAATAATTCATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116482211 Original CRISPR GGTGCAATAATTCATGTGGA AGG Intergenic
No off target data available for this crispr