ID: 1116483920

View in Genome Browser
Species Human (GRCh38)
Location 14:45424040-45424062
Sequence ATGCCCTTCTAGAAGAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116483920_1116483921 8 Left 1116483920 14:45424040-45424062 CCTTTACTCTTCTAGAAGGGCAT No data
Right 1116483921 14:45424071-45424093 TTTTTTTTTTTTCCCATAGTTGG 0: 2
1: 6
2: 78
3: 926
4: 6640
1116483920_1116483922 19 Left 1116483920 14:45424040-45424062 CCTTTACTCTTCTAGAAGGGCAT No data
Right 1116483922 14:45424082-45424104 TCCCATAGTTGGAGTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116483920 Original CRISPR ATGCCCTTCTAGAAGAGTAA AGG (reversed) Intergenic
No off target data available for this crispr