ID: 1116484233

View in Genome Browser
Species Human (GRCh38)
Location 14:45427660-45427682
Sequence AAGAGGGACCTGGGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116484225_1116484233 -6 Left 1116484225 14:45427643-45427665 CCCATGGGACCAGGGAAAAGAGG No data
Right 1116484233 14:45427660-45427682 AAGAGGGACCTGGGGCAAGAAGG No data
1116484227_1116484233 -7 Left 1116484227 14:45427644-45427666 CCATGGGACCAGGGAAAAGAGGG No data
Right 1116484233 14:45427660-45427682 AAGAGGGACCTGGGGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116484233 Original CRISPR AAGAGGGACCTGGGGCAAGA AGG Intergenic
No off target data available for this crispr