ID: 1116500029

View in Genome Browser
Species Human (GRCh38)
Location 14:45609430-45609452
Sequence TGTATCTAACAATTACCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116500029_1116500035 25 Left 1116500029 14:45609430-45609452 CCTCATGGTAATTGTTAGATACA No data
Right 1116500035 14:45609478-45609500 GGCCGATGGGAGAGATATGTTGG No data
1116500029_1116500034 12 Left 1116500029 14:45609430-45609452 CCTCATGGTAATTGTTAGATACA No data
Right 1116500034 14:45609465-45609487 AGATTTTCTGGTAGGCCGATGGG No data
1116500029_1116500036 26 Left 1116500029 14:45609430-45609452 CCTCATGGTAATTGTTAGATACA No data
Right 1116500036 14:45609479-45609501 GCCGATGGGAGAGATATGTTGGG No data
1116500029_1116500031 4 Left 1116500029 14:45609430-45609452 CCTCATGGTAATTGTTAGATACA No data
Right 1116500031 14:45609457-45609479 CTCCAGTTAGATTTTCTGGTAGG No data
1116500029_1116500030 0 Left 1116500029 14:45609430-45609452 CCTCATGGTAATTGTTAGATACA No data
Right 1116500030 14:45609453-45609475 TACTCTCCAGTTAGATTTTCTGG No data
1116500029_1116500033 11 Left 1116500029 14:45609430-45609452 CCTCATGGTAATTGTTAGATACA No data
Right 1116500033 14:45609464-45609486 TAGATTTTCTGGTAGGCCGATGG No data
1116500029_1116500038 30 Left 1116500029 14:45609430-45609452 CCTCATGGTAATTGTTAGATACA No data
Right 1116500038 14:45609483-45609505 ATGGGAGAGATATGTTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116500029 Original CRISPR TGTATCTAACAATTACCATG AGG (reversed) Intergenic
No off target data available for this crispr