ID: 1116500031

View in Genome Browser
Species Human (GRCh38)
Location 14:45609457-45609479
Sequence CTCCAGTTAGATTTTCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116500029_1116500031 4 Left 1116500029 14:45609430-45609452 CCTCATGGTAATTGTTAGATACA No data
Right 1116500031 14:45609457-45609479 CTCCAGTTAGATTTTCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116500031 Original CRISPR CTCCAGTTAGATTTTCTGGT AGG Intergenic
No off target data available for this crispr