ID: 1116500908

View in Genome Browser
Species Human (GRCh38)
Location 14:45619984-45620006
Sequence TGGCCTTATGGACGATCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116500905_1116500908 -3 Left 1116500905 14:45619964-45619986 CCTTCATTGCTTGTTTTTGATGG No data
Right 1116500908 14:45619984-45620006 TGGCCTTATGGACGATCAGATGG No data
1116500903_1116500908 27 Left 1116500903 14:45619934-45619956 CCTGCAATATTTATAGAATATGG No data
Right 1116500908 14:45619984-45620006 TGGCCTTATGGACGATCAGATGG No data
1116500902_1116500908 28 Left 1116500902 14:45619933-45619955 CCCTGCAATATTTATAGAATATG No data
Right 1116500908 14:45619984-45620006 TGGCCTTATGGACGATCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116500908 Original CRISPR TGGCCTTATGGACGATCAGA TGG Intergenic
No off target data available for this crispr