ID: 1116501305

View in Genome Browser
Species Human (GRCh38)
Location 14:45626158-45626180
Sequence CCTTCATTACAGAAGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116501302_1116501305 6 Left 1116501302 14:45626129-45626151 CCAAACTTTTTCTTCTTTATTTA No data
Right 1116501305 14:45626158-45626180 CCTTCATTACAGAAGATCAAAGG No data
1116501300_1116501305 28 Left 1116501300 14:45626107-45626129 CCCTCTAAATCTTACATATGAAC No data
Right 1116501305 14:45626158-45626180 CCTTCATTACAGAAGATCAAAGG No data
1116501301_1116501305 27 Left 1116501301 14:45626108-45626130 CCTCTAAATCTTACATATGAACC No data
Right 1116501305 14:45626158-45626180 CCTTCATTACAGAAGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116501305 Original CRISPR CCTTCATTACAGAAGATCAA AGG Intergenic
No off target data available for this crispr