ID: 1116504906

View in Genome Browser
Species Human (GRCh38)
Location 14:45665908-45665930
Sequence AGGAAGAACACAGCAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116504906_1116504916 20 Left 1116504906 14:45665908-45665930 CCCACAATTGCTGTGTTCTTCCT No data
Right 1116504916 14:45665951-45665973 TCTCCGCACCACACTGTGGAGGG No data
1116504906_1116504914 16 Left 1116504906 14:45665908-45665930 CCCACAATTGCTGTGTTCTTCCT No data
Right 1116504914 14:45665947-45665969 ATGCTCTCCGCACCACACTGTGG No data
1116504906_1116504919 24 Left 1116504906 14:45665908-45665930 CCCACAATTGCTGTGTTCTTCCT No data
Right 1116504919 14:45665955-45665977 CGCACCACACTGTGGAGGGGTGG No data
1116504906_1116504917 21 Left 1116504906 14:45665908-45665930 CCCACAATTGCTGTGTTCTTCCT No data
Right 1116504917 14:45665952-45665974 CTCCGCACCACACTGTGGAGGGG No data
1116504906_1116504915 19 Left 1116504906 14:45665908-45665930 CCCACAATTGCTGTGTTCTTCCT No data
Right 1116504915 14:45665950-45665972 CTCTCCGCACCACACTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116504906 Original CRISPR AGGAAGAACACAGCAATTGT GGG (reversed) Intergenic
No off target data available for this crispr