ID: 1116510027

View in Genome Browser
Species Human (GRCh38)
Location 14:45733635-45733657
Sequence TTATTCGGTCTACTATAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116510027_1116510032 4 Left 1116510027 14:45733635-45733657 CCCATCTATAGTAGACCGAATAA No data
Right 1116510032 14:45733662-45733684 AATGTGGTACATATATACCATGG 0: 572
1: 4982
2: 27832
3: 15763
4: 10164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116510027 Original CRISPR TTATTCGGTCTACTATAGAT GGG (reversed) Intergenic
No off target data available for this crispr