ID: 1116513572

View in Genome Browser
Species Human (GRCh38)
Location 14:45778674-45778696
Sequence CACATGGAACAACCTCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116513572_1116513576 14 Left 1116513572 14:45778674-45778696 CCATCTGGAGGTTGTTCCATGTG No data
Right 1116513576 14:45778711-45778733 ATATATATTTTGCTGTTGGTAGG No data
1116513572_1116513575 10 Left 1116513572 14:45778674-45778696 CCATCTGGAGGTTGTTCCATGTG No data
Right 1116513575 14:45778707-45778729 GAATATATATATTTTGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116513572 Original CRISPR CACATGGAACAACCTCCAGA TGG (reversed) Intergenic
No off target data available for this crispr