ID: 1116516872

View in Genome Browser
Species Human (GRCh38)
Location 14:45815192-45815214
Sequence CCTAATATCTAGAAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116516866_1116516872 17 Left 1116516866 14:45815152-45815174 CCAATAGCACAGGGGGTGTACAA No data
Right 1116516872 14:45815192-45815214 CCTAATATCTAGAAGGGGAAAGG No data
1116516867_1116516872 -6 Left 1116516867 14:45815175-45815197 CCACGTGTGATATTCTTCCTAAT No data
Right 1116516872 14:45815192-45815214 CCTAATATCTAGAAGGGGAAAGG No data
1116516865_1116516872 18 Left 1116516865 14:45815151-45815173 CCCAATAGCACAGGGGGTGTACA No data
Right 1116516872 14:45815192-45815214 CCTAATATCTAGAAGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116516872 Original CRISPR CCTAATATCTAGAAGGGGAA AGG Intergenic
No off target data available for this crispr