ID: 1116517169

View in Genome Browser
Species Human (GRCh38)
Location 14:45817064-45817086
Sequence CCTAATATGCAGGGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116517163_1116517169 -9 Left 1116517163 14:45817050-45817072 CCTGTGATATTGTTCCTAATATG No data
Right 1116517169 14:45817064-45817086 CCTAATATGCAGGGGGAAATAGG No data
1116517162_1116517169 18 Left 1116517162 14:45817023-45817045 CCAATAGAGCAGGGGGTATACAA No data
Right 1116517169 14:45817064-45817086 CCTAATATGCAGGGGGAAATAGG No data
1116517161_1116517169 19 Left 1116517161 14:45817022-45817044 CCCAATAGAGCAGGGGGTATACA No data
Right 1116517169 14:45817064-45817086 CCTAATATGCAGGGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116517169 Original CRISPR CCTAATATGCAGGGGGAAAT AGG Intergenic
No off target data available for this crispr