ID: 1116519238

View in Genome Browser
Species Human (GRCh38)
Location 14:45830331-45830353
Sequence GTGTACACCCCTTGCGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116519238_1116519242 17 Left 1116519238 14:45830331-45830353 CCAATATCGCAAGGGGTGTACAC No data
Right 1116519242 14:45830371-45830393 TCCTTATATCCAGAAAATAGAGG No data
1116519238_1116519244 18 Left 1116519238 14:45830331-45830353 CCAATATCGCAAGGGGTGTACAC No data
Right 1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116519238 Original CRISPR GTGTACACCCCTTGCGATAT TGG (reversed) Intergenic
No off target data available for this crispr