ID: 1116519240

View in Genome Browser
Species Human (GRCh38)
Location 14:45830357-45830379
Sequence ATATAAGGAACAATATCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116519240_1116519248 22 Left 1116519240 14:45830357-45830379 CCCTGTGATATTGTTCCTTATAT No data
Right 1116519248 14:45830402-45830424 ACTCCCAATATTGCACTGGGTGG No data
1116519240_1116519247 19 Left 1116519240 14:45830357-45830379 CCCTGTGATATTGTTCCTTATAT No data
Right 1116519247 14:45830399-45830421 ATTACTCCCAATATTGCACTGGG No data
1116519240_1116519246 18 Left 1116519240 14:45830357-45830379 CCCTGTGATATTGTTCCTTATAT No data
Right 1116519246 14:45830398-45830420 TATTACTCCCAATATTGCACTGG No data
1116519240_1116519242 -9 Left 1116519240 14:45830357-45830379 CCCTGTGATATTGTTCCTTATAT No data
Right 1116519242 14:45830371-45830393 TCCTTATATCCAGAAAATAGAGG No data
1116519240_1116519244 -8 Left 1116519240 14:45830357-45830379 CCCTGTGATATTGTTCCTTATAT No data
Right 1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116519240 Original CRISPR ATATAAGGAACAATATCACA GGG (reversed) Intergenic
No off target data available for this crispr