ID: 1116519244

View in Genome Browser
Species Human (GRCh38)
Location 14:45830372-45830394
Sequence CCTTATATCCAGAAAATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116519239_1116519244 -4 Left 1116519239 14:45830353-45830375 CCTTCCCTGTGATATTGTTCCTT No data
Right 1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG No data
1116519240_1116519244 -8 Left 1116519240 14:45830357-45830379 CCCTGTGATATTGTTCCTTATAT No data
Right 1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG No data
1116519238_1116519244 18 Left 1116519238 14:45830331-45830353 CCAATATCGCAAGGGGTGTACAC No data
Right 1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG No data
1116519241_1116519244 -9 Left 1116519241 14:45830358-45830380 CCTGTGATATTGTTCCTTATATC No data
Right 1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116519244 Original CRISPR CCTTATATCCAGAAAATAGA GGG Intergenic
No off target data available for this crispr